Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector

An oncolytic adenovirus and exogenous gene technology, applied in the field of oncolytic adenovirus vectors, can solve the problem of unsatisfactory treatment effect

Active Publication Date: 2014-04-23
SHAANXI NORMAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the negative correlation between the malignancy of the tumor and the adenovirus receptor, the therapeutic effect is not very satisfactory.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector
  • Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector
  • Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The oncolytic adenoviral vector HBD24-5 / 11F.Arresten / TRAIL expressing two exogenous genes modified by fibrin in this example is as follows:

[0050] 1. There is a 24 bp deletion between the 922bp-947bp in the human adenovirus vector type 5 genome. The missing 24bp base sequence is: CTTACCTGCCACCAGGCTGGCTTT.

[0051] 2. Insert an Arresten expression element between 28183bp and 29906bp in the human adenovirus vector type 5 genome. The sequence of the Arresten expression element is:

[0052] gtcgacacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcc

[0053] catatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgccc

[0054] attgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggag

[0055] tattacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtca

[0056] atgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacat

[0057] ctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggt...

Embodiment 2

[0154] In this example, the fibrin modified oncolytic adenoviral vector HBD24-5 / 11F.Endostatin / TRAIL expressing two foreign genes is as follows:

[0155] The first exogenous gene Arresten in Example 1 was replaced with Endostatin. The other structures are the same as those in Example 1, constituting an oncolytic adenoviral vector HBD24-5 / 11F.Endostatin / TRAIL that expresses two foreign genes modified by fibrin.

[0156] Its construction method is the same as in Example 1.

Embodiment 3

[0158] In this example, the fibrin modified oncolytic adenoviral vector HBD24-5 / 11F.IL-24 / TRAIL expressing two foreign genes is as follows:

[0159] The first exogenous gene Arresten in Example 1 was replaced with IL-24. The other structures are the same as in Example 1, which constitutes an oncolytic adenoviral vector HBD24-5 / 11F.IL-24 / TRAIL that expresses two foreign genes modified by fibrin.

[0160] Its construction method is the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin. The oncolytic adenovirus vector provided by the invention is characterized in that: a human adenovirus 5 type gene group has a lacking of 24bp basic group in 922bp-947bp; and an expression element for expressing a first exogenous gene is inserted into 28183bp-29906bp of the human adenovirus 5 type gene group, a fibrin chimera is inserted into 31042bp of the human adenovirus 5 type gene group and an expressing element for doubly expressing a second exogenous gene and an eGFP (Green Fluorescent Protein) is inserted into 32021bp and 32022bp of the human adenovirus 5 type gene group. A construction method of the oncolytic adenovirus vector provided by the invention comprises the following steps of: constructing a shuttle vector lacking pAd5 E1A 24bp, a pHBD24 adenovirus vector framework, a shuttle vector of a pHBDE3-first exogenous gene, a pHBDE3-first exogenous gene / SwaI condition copied adenovirus vector framework and a pshuttle Ad5-E4-fibrin chimera shuttle vector; expressing a shuttle vector / second exogenous gene-E4-fibrin embedding body sequence of the eGFP and the second exogenous gene; and preparing the oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin. The vector provided by the invention can be used for inhibiting malignant glioma, liver cancer, stomach cancer, colon cancer, breast cancer and melanoma.

Description

technical field [0001] The invention relates to the field of tumor gene therapy, in particular to an oncolytic adenoviral vector expressing two exogenous genes through modification of fibrin. Background technique [0002] Tumor is currently a large class of diseases that seriously threaten human life and health, and it is difficult to be completely cured by conventional treatment. As a new method of tumor treatment, gene therapy has an important application prospect in this field. In recent years, the most eye-catching adenoviral vector in tumor therapy is conditionally replicating oncolytic adenoviral vector (Conditionally Replicating Oncolytic Adenoviral Vector, CRAd). After this type of vector infects cells, it can selectively replicate rapidly in the tumor tissue, amplify in large quantities and eventually kill the tumor cells, and its progeny cells will infect the surrounding tumor cells and continue to replicate, eventually killing the surrounding tumors cells, and h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/861A61K48/00A61P35/00
Inventor 夏海滨李星
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products