Application method of low-methylation gene F10
A technology of methylation and gene transcription, applied in the application field of hypomethylated gene F10
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Methl primer express software and online software Methprimer analyzed the 5000bp region upstream of the F10 transcription start site, and the results showed that there was a CpG island in this region, and designed and synthesized methylation primers for the CpG island upstream of the F10 gene transcription start site, F: 5'TTTTATTTTTATGTATTAGGGGGTGAG 3', R: 5'TACAAACAATCCTAAATCATCAACC 3'. Genomic sequencing (BSP) of 10 cases of normal brain tissue treated with sulfite found that the CpG island upstream of the transcription start site of F10 gene was in a methylated state in normal brain tissue. At the same time, 96 cases of glioma tissue samples of different grades (14 cases of grade I, 48 cases of grade II, 28 cases of grade III, and 12 cases of grade IV) were tested for the methylation status of the F10 gene, and it was found that 82.3% of the brain F10 gene hypomethylation occurred in glioma tissue, compared with normal brain tissue, the difference was statistically ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com