Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application method of low-methylation gene F10

A technology of methylation and gene transcription, applied in the application field of hypomethylated gene F10

Active Publication Date: 2013-02-06
CENT SOUTH UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the expression and function of F10 gene in glioma.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application method of low-methylation gene F10
  • Application method of low-methylation gene F10
  • Application method of low-methylation gene F10

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Methl primer express software and online software Methprimer analyzed the 5000bp region upstream of the F10 transcription start site, and the results showed that there was a CpG island in this region, and designed and synthesized methylation primers for the CpG island upstream of the F10 gene transcription start site, F: 5'TTTTATTTTTATGTATTAGGGGGTGAG 3', R: 5'TACAAACAATCCTAAATCATCAACC 3'. Genomic sequencing (BSP) of 10 cases of normal brain tissue treated with sulfite found that the CpG island upstream of the transcription start site of F10 gene was in a methylated state in normal brain tissue. At the same time, 96 cases of glioma tissue samples of different grades (14 cases of grade I, 48 cases of grade II, 28 cases of grade III, and 12 cases of grade IV) were tested for the methylation status of the F10 gene, and it was found that 82.3% of the brain F10 gene hypomethylation occurred in glioma tissue, compared with normal brain tissue, the difference was statistically ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the application of a low-methylation gene F10, namely application of the low-methylation gene F10 in preparation of an agent for diagnosing, predicting, detecting or screening the cerebral gliomas, and particularly relates to application of the low-methylation gene F10 in preparation of an agent for predicting the prognosis of the cerebral gliomas by a hydrosulfite direct sequencing method. The research proves that the F10 is highly expressed in a glioma tissue due to low methylation, the detection for the low methylation of F10 gene is applied to predicting the prognosis of the gliomas, and a powerful molecular biology basis for predicting the prognosis of a glioma patients is provided, so that the application method of the low-methylation gene F10 has profound clinical significance and popularization property.

Description

technical field [0001] The invention relates to the application of hypomethylation gene F10 in preparing a reagent for predicting the prognosis of brain glioma patients. Background technique [0002] Epigenetic mechanisms such as promoter hyper / hypomethylation, histone modification or expression of non-coding RNA play very important functions in tumorigenesis. Changes in DNA methylation status are important markers of tumor development. The methylation levels of genes with tumor-promoting functions are reduced and highly expressed, thereby promoting the occurrence of various tumors, including glioma. [0003] Glioma is the most common primary tumor of the central nervous system. Although comprehensive treatment and some new treatment methods have been adopted, its prognosis is still unsatisfactory. A 2010 statistic showed that 75% of glioma patients in the United States died within 5 years of diagnosis. The prognosis of glioblastoma is even worse. A survival analysis of 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 武明花刘晓萍李桂源唐海林王泽友余志斌卞艳慧
Owner CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More