Application method of hypomethylated gene POTEH
A technology of hypomethylation and application methods, applied in biochemical equipment and methods, microbial determination/examination, etc. There is no reference standard for prognostic determination, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Using Bioinformatics software such as Promoterscan, Genomatix Promoter Inspector and CpGplot to carry out bioinformatics analysis on the 5' end sequence of POTEH gene, the results show that the promoter region of POTEH gene may be located at -817bp to -315bp (in the start codon ATG A is +1). The Methl primer express software and the online software Methprimer analyzed the predicted region of the POTEH promoter, and the results showed that there was a CpG island. The methylated primers for the POTEH promoter region were designed and synthesized, 5′TGATATTTGTGGTTTTAAAGATTTATGTAG 3′(F), 5′ATTACAAACCAACCAAACCATTAC 3′( R). Genomic sequencing (BSP) of 10 cases of normal brain tissue treated with sulfite found that the CpG sites in the CpG island of the POTEH gene promoter were all in a methylated state in normal brain tissue. At the same time, 96 cases of glioma tissue samples of different grades (14 cases of grade I, 48 cases of grade II, 28 cases of grade III, and 12 cases...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap