Application method of low-methylation gene LMO3 (LIM domain only 3)
A technology of methylation and gene promoter region, which is applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., can solve the problem of poor prognosis of neuroblastoma patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Using Bioinformatics software such as Promoterscan, Genomatix Promoter Inspector and CpGplot to carry out bioinformatics analysis on the 5' end sequence of LMO3 gene, the results show that the promoter region of LMO3 gene may be located at -581bp to 0bp (A in the start codon ATG for +1). Methl primer express software and online software Methprimer analyzed the predicted region of LMO3 promoter from -401bp to -219bp, the result showed a CpG island, designed and synthesized methylated primers for the LMO3 promoter region, 5′TAGTATATGTATGTGGTTGTGTTGA3′(F), 5′ ATATCCTCCTTTTAAACAACTACAA 3'(R). Genomic sequencing (BSP) of 10 normal brain tissues after sulfite treatment revealed that the CpG sites in the CpG island of the LMO3 gene promoter were all in a methylated state in normal brain tissues. At the same time, 50 cases of glioma tissue samples of different grades (6 cases of grade I, 20 cases of grade II, 12 cases of grade III, and 12 cases of grade IV) were tested for the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



