Unlock instant, AI-driven research and patent intelligence for your innovation.

Application method of low-methylation gene LMO3 (LIM domain only 3)

A technology of methylation and gene promoter region, which is applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., can solve the problem of poor prognosis of neuroblastoma patients

Active Publication Date: 2013-02-13
CENT SOUTH UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has been confirmed that LMO3 functions as an oncogene in neuroblastoma, it can interact with the neuronal transcription factor HEN2, and it can also inhibit the transcriptional activity of P53, and the prognosis of neuroblastoma patients with high expression of LMO3 is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application method of low-methylation gene LMO3 (LIM domain only 3)
  • Application method of low-methylation gene LMO3 (LIM domain only 3)
  • Application method of low-methylation gene LMO3 (LIM domain only 3)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Using Bioinformatics software such as Promoterscan, Genomatix Promoter Inspector and CpGplot to carry out bioinformatics analysis on the 5' end sequence of LMO3 gene, the results show that the promoter region of LMO3 gene may be located at -581bp to 0bp (A in the start codon ATG for +1). Methl primer express software and online software Methprimer analyzed the predicted region of LMO3 promoter from -401bp to -219bp, the result showed a CpG island, designed and synthesized methylated primers for the LMO3 promoter region, 5′TAGTATATGTATGTGGTTGTGTTGA3′(F), 5′ ATATCCTCCTTTTAAACAACTACAA 3'(R). Genomic sequencing (BSP) of 10 normal brain tissues after sulfite treatment revealed that the CpG sites in the CpG island of the LMO3 gene promoter were all in a methylated state in normal brain tissues. At the same time, 50 cases of glioma tissue samples of different grades (6 cases of grade I, 20 cases of grade II, 12 cases of grade III, and 12 cases of grade IV) were tested for the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of low-methylation gene LMO3 (LIM domain only 3), which is used for preparing a preparation for diagnosis, predication, detection or screening of cerebral gliomas, and is especially used for preparing a preparation for predicting cerebral gliomas prognosis by a direct sequencing method of hydrosulfite. Studies prove that high expression is generated on the LMO3 in cerebral gliomas tissues due to low methylation of promoters, the detection for low methylation of the LMO3 genes is applied in prediction of the cerebral gliomas prognosis, and powerful basis of molecular biology is provided for predicting the prognosis of patients with cerebral gliomas. The application method has profound clinic significance and popularization.

Description

technical field [0001] The present invention relates to the application of hypomethylation gene LMO3 in preparing a reagent for predicting the prognosis of patients with brain glioma. Background technique [0002] Glioma is the most common malignant tumor of the human central nervous system. The current treatment methods include surgery combined with chemotherapy and radiotherapy, but the survival time of glioma patients has not been significantly prolonged. According to reports, the 5-year survival rate of patients with glioma is less than 25%, while the average overall survival time of patients with glioblastoma is 12.3 months. At present, there is no reference standard for the prognosis of glioma, and there is no specific index, which is far from meeting the needs of the prognosis of human glioma. Therefore, judging the prognosis of human glioma in order to select the best treatment plan and significantly improve the survival rate of patients has become an important subj...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 武明花刘晓萍李桂源唐海林王泽友余志斌卞艳慧
Owner CENT SOUTH UNIV