Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method

A technology of real-time fluorescence quantification and detection method, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc. It can solve the problems of internal standard inhibition, inability to amplify, and false negatives, so as to avoid false negatives and false negatives. The effect of a negative result

Active Publication Date: 2012-04-25
SANSURE BIOTECH INC
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a real-time fluorescent quantitative PCR detection method to solve the technical problems that when the target gene concentration is high, the internal standard is inhibited when the competitive internal standard method is used, the amplification cannot be performed, and false negatives are prone to occur.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method
  • Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method
  • Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Real-time fluorescent quantitative PCR detection of negative and low concentration HBV-DNA in serum

[0056] Use the software such as Seq Man and Meg Align in the DNA Star software package to compare the homology of the sequences of the HBV genotypes (A to H) retrieved from the Genbank, and find out the homologous conserved segments and conserved segment sequences is: 5'-GTGTCTGCGGCGTTTTATCATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3'.

[0057] With the aid of the primer design software Primer Express 3.0 and Primer Premier 5.0 software, and through the search and analysis of the Blast tool in the GenBank database, a set of primers and the first probe were designed, and the 5' end of the first probe used the first fluorescent The reporter group FAM is labeled, and the 3' end is labeled with a non-fluorescent quencher (Dabcyl) to reduce background interference. The sequence of the upstream primer HBV-F1 is 5'-GTG TCT GCG...

Embodiment 2

[0080] Embodiment 2: Real-time fluorescent quantitative PCR detection of high concentration HBV-DNA in serum

[0081] The design and sequence of the internal standard, primers, probes are the same as in Example 1, and the concentration of 1 HBV-DNA containing the target gene is 5 × 10 7 Serum samples of IU / ml were diluted 10 times (the concentration of HBV-DNA was 5×10 6 IU / ml), diluted 100 times (HBV-DNA concentration is 5×10 5 IU / ml), diluted 1000 times (HBV-DNA concentration is 5×10 4 IU / ml), 4 samples were obtained as the samples to be tested, and were processed synchronously with the internal standard plasmid, and high-purity nucleic acid was obtained through nucleic acid extraction and purification steps, and the nucleic acid was added to the PCR reaction solution for fluorescence quantitative PCR experiment (fluorescence quantitative PCR Absolute quantitative experiments were performed on an instrument model ABI7300, produced by Applied Biosystems, USA.

[0082] The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention provides a real-time fluorescent quantitative PCR (polymerase chain reaction) detection method. Based on the conventional PCR detection method, a target-gene-oriented homologous regional supplement probe is added, thereby having a monitoring effect like an internal standard. By using the method to carry out real-time fluorescent PCR, the false negative phenomenon can be avoided.

Description

technical field [0001] The present invention relates to the field of real-time fluorescent quantitative PCR, in particular to a real-time fluorescent quantitative PCR detection method. Background technique [0002] Polymerase chain reaction (Polymerase Chain Reaction, PCR) is a technique for detecting target genes by amplifying selective fragments of genes in vitro. According to different amplification strategies and means of detecting products, PCR can be divided into qualitative and quantitative. Real-time quantitative PCR (Real-time Quantitative Polymerase Chain Reaction, RQ-PCR) is to add a fluorescent label probe during the amplification process of the target gene, and at the same time combine nucleic acid amplification, hybridization and spectral technology to achieve target Accurate quantitative detection of genes. RQ-PCR has high sensitivity, high precision and high throughput. [0003] Compared with other clinical testing techniques, real-time quantitative PCR te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor戴立忠熊晓燕邓中平
OwnerSANSURE BIOTECH INC