Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method
A technology of real-time fluorescence quantification and detection method, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc. It can solve the problems of internal standard inhibition, inability to amplify, and false negatives, so as to avoid false negatives and false negatives. The effect of a negative result
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Real-time fluorescent quantitative PCR detection of negative and low concentration HBV-DNA in serum
[0056] Use the software such as Seq Man and Meg Align in the DNA Star software package to compare the homology of the sequences of the HBV genotypes (A to H) retrieved from the Genbank, and find out the homologous conserved segments and conserved segment sequences is: 5'-GTGTCTGCGGCGTTTTATCATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3'.
[0057] With the aid of the primer design software Primer Express 3.0 and Primer Premier 5.0 software, and through the search and analysis of the Blast tool in the GenBank database, a set of primers and the first probe were designed, and the 5' end of the first probe used the first fluorescent The reporter group FAM is labeled, and the 3' end is labeled with a non-fluorescent quencher (Dabcyl) to reduce background interference. The sequence of the upstream primer HBV-F1 is 5'-GTG TCT GCG...
Embodiment 2
[0080] Embodiment 2: Real-time fluorescent quantitative PCR detection of high concentration HBV-DNA in serum
[0081] The design and sequence of the internal standard, primers, probes are the same as in Example 1, and the concentration of 1 HBV-DNA containing the target gene is 5 × 10 7 Serum samples of IU / ml were diluted 10 times (the concentration of HBV-DNA was 5×10 6 IU / ml), diluted 100 times (HBV-DNA concentration is 5×10 5 IU / ml), diluted 1000 times (HBV-DNA concentration is 5×10 4 IU / ml), 4 samples were obtained as the samples to be tested, and were processed synchronously with the internal standard plasmid, and high-purity nucleic acid was obtained through nucleic acid extraction and purification steps, and the nucleic acid was added to the PCR reaction solution for fluorescence quantitative PCR experiment (fluorescence quantitative PCR Absolute quantitative experiments were performed on an instrument model ABI7300, produced by Applied Biosystems, USA.
[0082] The ...
PUM
Property | Measurement | Unit |
---|---|---|
melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com