Large yellow croaker interleukin-1beta (IL-1beta) gene cloning method and application thereof
A technology of interleukin and cloning method, which is applied in the field of large yellow croaker interleukin-1β (IL-1β) gene and its cloning, can solve the problem of no large yellow croaker and the like, and achieves good application prospects, environmental friendliness and wide application effect of value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] A cloned large yellow croaker interleukin-1β gene in this embodiment has the base sequence of SEQ ID NO.1 in the sequence listing.
[0018] (1) Information for SEQ ID NO 1 (see sequence listing)
[0019] (a) Sequential features:
[0020] * Length: 1295 base pairs
[0021] * Type: nucleic acid
[0022] * Chain type: double chain
[0023] * Topology: linear
[0024] (b) Molecule type: cDNA
[0025] (c) Assumption: No
[0026] (d) Antisense: No
[0027] (e) Original source: Large yellow croaker ( Pseudosciaena crocea ).
[0028] A cloned large yellow croaker interleukin-1β gene in this example has the amino acid sequence shown in SEQ ID NO.2 in the sequence listing:
[0029] (2) Information of SEQ ID NO.2 (see sequence listing)
[0030] (a) Sequential features
[0031] * Length: 255 amino acids
[0032] * Type: amino acid
[0033] * Chain type: single chain
[0034] * Topology: Linear
[0035] (b) Molecule Type: Protein
[0036] Among them, the cloning ...
Embodiment 2
[0073] In this example, the large yellow croaker interleukin-1β gene obtained by the cloning method in Example 1 has the function of improving the disease resistance of large yellow croaker.
[0074] First, according to the analysis of the multiple cloning site of the prokaryotic expression vector PGEX-4T-2 (purchased from Amersham Company) and the enzyme cutting site in the ORF of the large yellow croaker IL-1β gene, BamH Ⅰ and EcoR were designed on the upstream and downstream primers of the gene, respectively. ⅠTwo enzyme cutting sites, BamH Ⅰ is GGATCC, EcoR Ⅰ is GAATTC (the underlined part in the primer sequence), and a protective base is added (CG in front of the underlined sequence in the sequence below), and the primer sequence is the upstream primer F-ex 5' CG GGATCC ATGGAATCTGAGATGAAATGC -3', the downstream primer sequence is R-ex 5'CG GAATTC TCAGGCCTGACCCTCAGTT3'.
[0075] The PCR reaction system for amplifying the IL-1β gene fragment was: 10×Taq buffer 2 μL, dNT...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
