Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Large yellow croaker interleukin-1beta (IL-1beta) gene cloning method and application thereof

A technology of interleukin and cloning method, which is applied in the field of large yellow croaker interleukin-1β (IL-1β) gene and its cloning, can solve the problem of no large yellow croaker and the like, and achieves good application prospects, environmental friendliness and wide application effect of value

Inactive Publication Date: 2012-07-18
JIMEI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large number of studies have found that IL-1β plays an important role in the occurrence and development of various diseases [Dinarello CA. The IL-1 family and inflammatory diseases. Clin Exp Rheumatol, 2002, 20 (5 Suppl 27): S1-S13], however, there is no report of the IL-1β sequence of large yellow croaker at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Large yellow croaker interleukin-1beta (IL-1beta) gene cloning method and application thereof
  • Large yellow croaker interleukin-1beta (IL-1beta) gene cloning method and application thereof
  • Large yellow croaker interleukin-1beta (IL-1beta) gene cloning method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] A cloned large yellow croaker interleukin-1β gene in this embodiment has the base sequence of SEQ ID NO.1 in the sequence listing.

[0018] (1) Information for SEQ ID NO 1 (see sequence listing)

[0019] (a) Sequential features:

[0020] * Length: 1295 base pairs

[0021] * Type: nucleic acid

[0022] * Chain type: double chain

[0023] * Topology: linear

[0024] (b) Molecule type: cDNA

[0025] (c) Assumption: No

[0026] (d) Antisense: No

[0027] (e) Original source: Large yellow croaker ( Pseudosciaena crocea ).

[0028] A cloned large yellow croaker interleukin-1β gene in this example has the amino acid sequence shown in SEQ ID NO.2 in the sequence listing:

[0029] (2) Information of SEQ ID NO.2 (see sequence listing)

[0030] (a) Sequential features

[0031] * Length: 255 amino acids

[0032] * Type: amino acid

[0033] * Chain type: single chain

[0034] * Topology: Linear

[0035] (b) Molecule Type: Protein

[0036] Among them, the cloning ...

Embodiment 2

[0073] In this example, the large yellow croaker interleukin-1β gene obtained by the cloning method in Example 1 has the function of improving the disease resistance of large yellow croaker.

[0074] First, according to the analysis of the multiple cloning site of the prokaryotic expression vector PGEX-4T-2 (purchased from Amersham Company) and the enzyme cutting site in the ORF of the large yellow croaker IL-1β gene, BamH Ⅰ and EcoR were designed on the upstream and downstream primers of the gene, respectively. ⅠTwo enzyme cutting sites, BamH Ⅰ is GGATCC, EcoR Ⅰ is GAATTC (the underlined part in the primer sequence), and a protective base is added (CG in front of the underlined sequence in the sequence below), and the primer sequence is the upstream primer F-ex 5' CG GGATCC ATGGAATCTGAGATGAAATGC -3', the downstream primer sequence is R-ex 5'CG GAATTC TCAGGCCTGACCCTCAGTT3'.

[0075] The PCR reaction system for amplifying the IL-1β gene fragment was: 10×Taq buffer 2 μL, dNT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a large yellow croaker interleukin-1beta (IL-1beta) gene and a cloning method thereof, wherein the large yellow croaker interleukin-1beta (IL-1beta) gene contains a base sequence shown as SEQ ID NO.1 and an amino acid sequence shown by SEQ ID NO.2. The large yellow croaker interleukin-1beta (IL-1beta) gene and the cloning method thereof, disclosed by the invention, have good application prospect in large yellow croaker disease prevention and further development of medical products, and foundation is laid for breeding for disease resistance in large yellow croaker molecular marker aided selection and detecting health state of fishes.

Description

technical field [0001] The invention relates to a large yellow croaker interleukin-1β (IL-1β) gene and a cloning method thereof, belonging to the technical field of molecular biology. Background technique [0002] Interleukin-1 is a cytokine discovered in 1972. Due to its diverse functions, it is also known as lymphocyte activating factor, endogenous transmitter of leukocytes, endogenous pyrogen, etc. It is a major Hormone-like peptide substances that play an immunomodulatory role, that is, pro-inflammatory cytokines [1.Bazan JF, Timans JC, Kastelein RA. A newly defined interleukin-1? Nature 1996, 379 f6566): 591]. IL-1β is the main secreted form of IL-1. Compared with IL-1α, IL-1β can act on target cells through long-distance secretion, and its role in inflammatory response is more significant [Leon LR. Invited review: cytokine regulation of fever: studies using gene knockout mice. J Appl Physiol, 2002, 92(6):2648-2655]. IL-1β generally has no precursor storage. When IL...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/25C12N15/10C07K14/545A61K39/39
Inventor 姚翠鸾王志勇黄雪娜
Owner JIMEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com