Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker related to porcine leukocyte count and application of molecular marker

A technology of molecular markers and white blood cells, applied in DNA/RNA fragments, recombinant DNA technology, etc.

Active Publication Date: 2013-10-09
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But none of them can fundamentally solve the problem of disease prevention. Improving the body's natural disease resistance has become the focus of current research, especially disease-resistant breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to porcine leukocyte count and application of molecular marker
  • Molecular marker related to porcine leukocyte count and application of molecular marker
  • Molecular marker related to porcine leukocyte count and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1, the screening of SN gene SNPs

[0028] 1.1 Primer design

[0029] According to the mRNA information of the SN gene in the NCBI database (GenBank accession number: DQ176853), a pair of primers were designed on exon 2 and exon 7 to amplify "Tongcheng pig" (Chinese local pig breed bloodline, local breed commercial variety in Tongcheng County, Hubei Province, a well-known public ) and "Landrace pig" (an imported breed with foreign pig blood, introduced from the United States by the National Livestock Engineering Center of Huazhong Agricultural University, a foreign commercial pig breed that has been popularized and applied on a large scale) the mRNA of the SN gene. The designed primer pair The nucleotide sequence is as follows:

[0030] SN CD3 F 5′ CTATGACTACTC AGGCAAGCG 3′,

[0031] SN CD3 R 5' GGTGT CAGGCATCAG GCTC 3'.

[0032] 1.2PCR amplification

[0033] The total volume of the PCR reaction is 10 μl, which contains about 100 ng of cDNA reverse-tra...

Embodiment 2

[0044] The establishment of embodiment 2SN gene PCR-RFLP diagnosis method

[0045] 2.1 Primer sequence

[0046] A pair of primers containing exon 4 for amplifying the genome sequence of porcine SN was designed to detect the polymorphism of the variation site in the population. The primer pair name and nucleotide sequence are as follows:

[0047] SN SNP F 5′CGGCTGCTGTAGCTCTGATTG 3′

[0048] SN SNP R 5′GCCTTGGCCTGGTTTCCTTA 3′

[0049] 2.2PCR amplification conditions

[0050] The total volume of the PCR reaction is 10μl, including about 100ng of porcine genomic DNA, containing 1×PCR buffer (purchased from Treasure Bioengineering Dalian Co., Ltd.), the final concentration of dNTP is 150μmol / L, the final concentration of primers is 0.4μmol / L, and 0.5U Taq DNA polymer Enzymes (purchased from Treasure Bioengineering Dalian Co., Ltd.). The PCR amplification program is: 94°C for 3min, 35×(94°C for 30s, 61°C for 30s, 72°C for 25s), and finally 72°C for 5min. The PCR reaction prod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of preparation of molecular markers of domestic animals and particularly relates to a molecular marker related to a porcine leukocyte count, and application of the molecular marker to marker-assisted selection of pigs. The molecular marker is a fragment of an SN gene; a nucleotide sequence of mRNA of the molecular marker is shown as a sequence table SEQ ID NO: 1; a mutant allele exists on a 699 bp site of the sequence table, namely a 367G-367A mutant exists on a 367bp site of a sequence shown as figure 4, which results in Hin6I-RFLP polymorphism. The invention further discloses a primer for amplifying the nucleotide sequence of the SN gene and a polymorphism detection method. The invention further discloses application of the prepared molecular marker to correlation analysis on the porcine leukocyte count; and a new molecular marker is provided for the marker-assisted selection of the pigs.

Description

technical field [0001] The invention belongs to the technical field of livestock molecular marker preparation, and in particular relates to a molecular marker related to the number of white blood cells in pigs and its application. The invention includes the discovery and detection method of the SN gene variation site related to the number of pig white blood cells and its application in pig marker-assisted selection. Background technique [0002] In the past 10 years, modern breeding technology has significantly improved pig production performance (growth, carcass and meat quality traits), but insufficient attention has been paid to the genetic improvement of pig health and disease resistance. Disease control has always been an important link in animal husbandry production. Preventive measures such as improving management levels, improving sanitation, injecting drugs and vaccines have indeed played an important role in preventing the occurrence of diseases. But none of them ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 刘榜王凤丽邱海芳徐学文彭中镇
Owner HUAZHONG AGRI UNIV