Meretrix intracellular copper zinc superoxide dismutase gene and application thereof

A technology of superoxide and clam cells, applied in plant gene improvement, application, genetic engineering, etc., can solve the problems that have not been reported on clam Cu/Zn-SOD gene research, etc., and achieve the effect of broad application prospects

Inactive Publication Date: 2012-12-05
LIAONING OCEAN & FISHERIES SCI RES INST
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no research report on

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Meretrix intracellular copper zinc superoxide dismutase gene and application thereof
  • Meretrix intracellular copper zinc superoxide dismutase gene and application thereof
  • Meretrix intracellular copper zinc superoxide dismutase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Cloning of clam intracellular copper-zinc superoxide dismutase gene

[0024] In the present invention, clams infected with Vibrio anguillaris used in the examples were collected from the mouth of Shuangtaizi River, Panshan County, Liaoning Province. Total RNA of clams was extracted from their hemolymph.

[0025] (1) Extraction of clam total RNA and purification of mRNA: collect hemolymph from the adductor muscle of clam infected with Vibrio anguillarum with a syringe, centrifuge at 700g for 10 minutes at 4°C, and use E.Z.N.A. TM Total RNA Midi Kit reagents and refer to its instructions to extract total RNA.

[0026] (2) Clam cDNA library construction:

[0027] Using Oligotex from QIAGENE TM -dT30 The mRNA purification kit (Takara) was used to isolate and purify mRNA. According to Creator TM SMART cDNA library construction kit (Clontech) instructions, take 3 μL total RNA, add 1 μL SMART Ⅳ Oligonucleotide, 1 μL CDS Ⅲ / 3'PCR Primer; act at 72°C for 2 minut...

Embodiment 2

[0045] Example 2. Recombinant expression of clam intracellular copper-zinc superoxide dismutase gene and application of recombinant expression products

[0046] (1) Primers

[0047] Set primers according to the sequence table SEQ ID NO.2 Chinese clam intracellular copper zinc superoxide dismutase corresponding to the cDNA sequence, introduce two different restriction endonuclease mutation sites, and design a restriction enzyme cutting site with Ecor I The forward primer SEQ ID NO.4 and the reverse primer SEQ ID NO.5 with Xho I restriction endonuclease site were used to amplify the ORF of Mm-Cu / Zn-SOD.

[0048] SEQ ID NO.4 CG gaattc atgtcgttaatagatgcagtgtgtg forward primer

[0049] SEQ ID NO.5 Ccg ctcgag ttatttcttcttaattccaatgacacc reverse primer

[0050] (2) Construction of the cloning vector PMD-Mm-Cu / Zn-SOD

[0051] The amplified product was recovered by gel cutting (TaKaRa Agarose Gel DNA Purification Kit Ver.2.0: Treasure Bioengineering Dalian Co., L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a cloning process and an application of meretrix intracellular copper zinc superoxide dismutase gene. The complementary deoxyribonucleic acid (cDNA) library establishment technology, the expressed sequence tag (EST) analysis technology and 3'RACE technology are used for studying meretrix intracellular copper zinc superoxide dismutase gene, the intracellular copper zinc superoxide dismutase gene is cloned from the meretrix at first time and has an alkali-based sequence expressed by SEQ ID NO.1, and a coded protein of the intracellular copper zinc superoxide dismutase gene has the amino sequence expressed by SEQ ID NO.2. The gene can be used for the in-vitro recombination expression and gene transfer of the intracellular copper zinc superoxide dismutase gene, so that a foundation is set for the development of medical products, study of meretrix immunity research, genetic breeding and improvement and disease control.

Description

technical field [0001] The invention relates to the amplification, expression and application of clam intracellular copper-zinc superoxide dismutase gene (cDNA full-length sequence and amino acid sequence). Background technique [0002] Meretrix meretrix is ​​an important species of tidal flat shellfish, mainly distributed in the coasts of Korea, Japan, Vietnam, India and China. In my country, it is mainly distributed in sea areas such as Liaohe Estuary in Liaoning, Yellow River Estuary in Shandong, Yangtze River Estuary in Jiangsu and Beihai in Guangxi. It is one of the main export fresh aquatic products in my country. In the past ten years, due to diseases and other reasons, especially the spread of red meat disease, the development of clam breeding industry has been severely restricted. Therefore, research on clam diseases, especially its autoimmune resistance, has become an important way to solve the bottleneck of the clam industry. [0003] As an important immune-rela...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N9/08C12N15/63C12N1/21C12N15/10C12Q1/68A61K38/44A61P37/02C12R1/19
Inventor 高祥刚赫崇波李宏俊刘卫东王志松李云峰鲍相勃
Owner LIAONING OCEAN & FISHERIES SCI RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap