Supercharge Your Innovation With Domain-Expert AI Agents!

Construction and application of polygene knockout strain of Halomonas sp. TD01

A Halomonas and gene technology, which is applied in the construction and application field of Halomonas multigene knockout strains, can solve the problems of poor material performance, low propionic acid conversion rate and low proportion, etc.

Active Publication Date: 2014-04-16
BLUEPHA CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Halomonas sp.TD01 can carry out non-sterile continuous fermentation to produce PHA, and can synthesize polyhydroxybutyrate (polyhydroxybutyrate, PHB for short) when glucose is used as the single carbon source. PHB content of 80% of the dry weight of the bacteria, and poly(3-hydroxybutyrate-co-3-hydroxyvalerate), referred to as PHBV) was synthesized when propionic acid or valeric acid was used as an auxiliary carbon source. However, due to the low conversion rate of propionic acid, the proportion of 3-hydroxyvalerate (3HV) monomer in PHBV is very low, and the material performance is poor.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of polygene knockout strain of Halomonas sp. TD01
  • Construction and application of polygene knockout strain of Halomonas sp. TD01
  • Construction and application of polygene knockout strain of Halomonas sp. TD01

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1. Construction of Halomonas sp.TD04 strain and its functional identification (knockout of 2-methylcitrate synthase (PrpC))

[0079]After experiments, it was found that the suicide plasmid (pRE112-phaABC-6IsceI, a plasmid that cannot replicate in Halomonas) mediated genomic DNA knockout technology using homologous recombination was suitable for Halomonas sp.TD01 Efficient knockout method. The advantage is that the genomic DNA can be completely deleted and mutated without the possibility of reverse mutation, and at the same time, no resistance markers will be introduced into the genomic DNA, which is beneficial to the subsequent molecular biology work. By optimizing the negative screening method, that is, by additionally expressing the homing endonuclease I-SceI, cutting at the 6 I-SceI sites of the genome of the insertion mutant produces a double-stranded DNA gap, which can strongly induce the second homologous recombination Compared with the traditional high s...

Embodiment 2

[0167] Example 2. Construction of Halomonas sp.TD08 strain and its functional identification (knockout of 3 PhaZ and PrpC)

[0168] 1. Construction of Halomonas sp.TD08 strain

[0169] 1. Construction of Halomonas sp.TD02

[0170] 1) Construction of the knockout vector pRE112-phaABC-6IsceI-B

[0171] Using the genomic DNA of Halomonas sp.TD01 as a template, primers Z1424-H1-F (ATCGTCTAGATTGAGCTGCTCTTACCTAGAGAG) and Z1424-H1-R ( TGACCAGGCATGCCCAGCTC GGTCAATACCCCCAATTCCGC) was amplified to obtain a 500bp PCR product (Z1424-H1 fragment, the upstream homology arm of the gene encoding PHA degrading enzyme 1); use Z1424-H2-F ( GCGGAATTGGGGTATTGACC GAGCTGGGCATGCCTGGTCA) and Z1424H2-R (ATCGGAGCTCTCTGAGCGGCTGGCGTTAAG) were amplified to obtain a 497bp product (Z1424-H2 fragment, the downstream homology arm of the gene encoding PHA degrading enzyme 1).

[0172] Using the Z1424-H1 fragment and the Z1424-H2 fragment as templates, and using Z1424-H1-F and Z1424-H2-R as primers, PCR was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction and application of a polygene knockout strain of Halomonas sp. TD01. The invention provides a recombinant strain which is obtained by inactivating one or more genes related to metabolic pathways of propionic acid in the Halomonas sp. TD01 used for producing polyhydroxyalkanoate (PHA). The one or more genes related to metabolic pathways of propionic acid are at least one selected from the group consisting of a coding gene for 2-methylcitrate synthetase, a coding gene for PHA digestive enzyme 1, a coding gene for PHA digestive enzyme 2 and a coding gene for PHA digestive enzyme 3. According to results of experiments in the invention, molecular modification is carried out on the Halomonas sp. TD01 to knock out 2-methylcitrate synthetase PrpC and three PHA digestive enzymes so as to obtain the novel recombinant strain, poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) with more excellent material performance can be highly efficiently produced by utilizing propionic acid, and the proportion of 3-hydroxyvaleric acid monomers in the produced PHBV and the conversion rate of the substrate propionic acid are substantially improved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the construction and application of Halomonas multigene knockout strains. Background technique [0002] Polyhydroxyalkanoates (PHA) is an environmentally friendly plastic with good biocompatibility, biodegradability, piezoelectricity and other excellent properties. In recent years, it has become the most active research field in the field of biomaterials. It becomes a new material that can replace petrochemical plastics and solve energy crisis and environmental pollution. [0003] PHA is a kind of storage particle that can be used as a carbon source and energy source synthesized by many microorganisms under the condition of carbon and nitrogen nutrition imbalance, and can be obtained through microbial fermentation. Although the PHA industry chain has developed rapidly in the past decade, the complexity of the PHA manufacturing process makes its manufacturing cost high and cannot com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/74C12P7/62C12R1/01
Inventor 陈国强谭丹李腾
Owner BLUEPHA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More