Fusion promoter pCLdb with both low temperature induction activity and potato tuber specific expression activity and construction method thereof

A low-temperature induction and potato block technology, which is applied in DNA preparation, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of low low-temperature induction activity, accumulation of reducing sugar in tubers, prolonging the processing time of potato tubers, etc. activity, increased expression activity, and small sequence differences

Inactive Publication Date: 2015-04-22
HUAZHONG AGRI UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In order to prolong the processing time of potato tubers and prevent water evaporation, the harvested tubers are generally stored at low temperature. However, the "low temperature saccharification" that occurs during storage will lead to the accumulation of reducing sugars in the tubers and affect the quality of potato processing.
This process involves a complex metabolic network, and the efficiency of traditional cross-breeding is extremely low. Therefore, there are currently less than 10 varieties suitable for processing in the world.
However, due to the low temperature-induced activity of the promoter (only about 20% of that of the CaMV 35S promoter), it cannot meet the actual application needs of improving potato tuber resistance to low-temperature saccharification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion promoter pCLdb with both low temperature induction activity and potato tuber specific expression activity and construction method thereof
  • Fusion promoter pCLdb with both low temperature induction activity and potato tuber specific expression activity and construction method thereof
  • Fusion promoter pCLdb with both low temperature induction activity and potato tuber specific expression activity and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] Example 1 Construction of fusion promoter pCLdb

[0013] The concrete method that the present invention obtains fusion promoter pCLdb is as follows:

[0014] Based on the pCL promoter, the base mutation of the CRT / DRE flanking sequence and the repetition of the CRT / DRE element are introduced into it, and the required base modification is introduced into pCL by introducing an overlap extension sequence in the primer, and the overlap extension PCR The primers used in the procedure are as follows:

[0015] Table 1 The sequences of the PCR primers used

[0016] name

sequence

ZL01L

TCCAAGCTTATTGAGAACGACCCT

M1b

AGAGGTCGGCCATCAAGTGATCG

M1b

GATCACTTGATGGCCGACCTCTTTTTT

M2B

AAGAGGTCGGCCATCAAGTGATCGAAGAAGAA

M2B

GATCACTTGATGGCCGACCTCTTTTTTCTGAAAACC

ZC01R

CGCGGATCCATTTTGTTGGTGCTT

[0017] First, two fragments b1L and b1R were amplified from the pCL promoter by using Pyrobest enzyme, and the PCR p...

Embodiment 2

[0034] Example 2: Construction of mutant fusion promoter and plant expression vector

[0035] pCLdb was double digested with HindIII and BamHI, and then cloned into the corresponding site of plasmid pUC18 to obtain recombinant plasmid pCLdb-18. Plasmid pCLdb-19 was double-digested with restriction endonucleases HindIII and BamHI, and the corresponding promoter fragments were respectively recovered and ligated with the large vector fragment recovered from pBI121 plasmid by double-digestion of HindIII and BamHI. Take 10 μL of ligation products to transform Escherichia coli DH5α competent cells respectively. After the transformants grew into colonies, a single colony was picked to prepare a small amount of plasmid DNA, which was identified by enzyme digestion with HindIII and BamHI, and the resulting recombinant plasmid was named pCLdb-121. The obtained recombinant plasmid was directly introduced into Agrobacterium LBA4404 for plant transformation.

Embodiment 3

[0036] Example 3: Potato transformation and detection of GUS expression activity

[0037]Potato Transformation: The plant expression vector was transformed into Agrobacterium LBA4404. Potatoes were transformed by the test-tube potato slice method in MS medium containing kanamycin and cephalosporin (MS basic medium + 3% sucrose + 1 mg / L IAA + 0.2 mg / L GA3 + 0.5 mg / L BA + 2 mg / L ZT + 75 mg / L Km + 400 mg / L Cef, pH 5.8) to select resistant plants; then transfer them to rooting medium (MS minimal medium + 50 mg / L Km + 200 mg / L Cef, pH5.8) to take root, and then reproduced by tissue culture; when the plant grows to about 30 days, select the leaves of the plant with normal growth, and use the CTAB method to extract the plant genomic DNA; using the genomic DNA as a template, by PCR Methods To detect the integration of exogenous genes, the primers used in PCR are promoter vector-specific primers P-Hind3 (ACCATGATTACGCCAAGCTT) and P-BamHI (GACTGACCACCCGGGGATCC), which can specifically...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a fusion promoter pCLdb with both low temperature induction activity and potato tuber specific expression activity. The nucleotide sequence of the promoter is shown as SEQ ID NO. 1. According to the promoter, CRT (cathode ray tube) / DRE (direct recoding electronic) element flanking sequence of a gene promoter of the other low temperature induction promoter cor15b of arabidopsis and a fusion promoter pCL are taken as the basis to construct the fusion promoter pCLdb. The promoter pCLdb is constructed into a plant expression vector pBI121, the constructed vector is named as pCLdb-121, the constructed pCLdb-121 is used for converting potatoes, the expression strength of the promoter is evaluated by GUS (glucuronidase) enzyme activity detection, the GUS activity detection shows that the expression strength of the pCLdb is remarkably increased compared with that of the pCL, the expression strength of the pCLdb is higher than that of the promoter CaMV 35S commonly used at present, and the fusion promoter pCLdb can be used for improvement of potato tuber and low temperature character related gene engineering.

Description

technical field [0001] The invention belongs to the technical research field of eukaryotic gene expression regulation, and relates to a fusion promoter with both low-temperature induction activity and potato tuber-specific expression activity and a construction method thereof. Background technique [0002] In order to prolong the processing time of potato tubers and prevent water evaporation, the harvested tubers are generally stored at low temperature. However, the "low temperature saccharification" that occurs during storage will lead to the accumulation of reducing sugars in the tubers and affect the quality of potato processing. This process involves a complex metabolic network, and the efficiency of traditional hybrid breeding is extremely low. Therefore, there are currently less than 10 varieties suitable for processing in the world. The improvement of this trait by transgenic technology is the main strategy. However, most of the genes involved in low-temperature sacc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/10
Inventor柳俊李萌朱青谢从华宋波涛
OwnerHUAZHONG AGRI UNIV