Fusion promoter pCLdb with both low temperature induction activity and potato tuber specific expression activity and construction method thereof
A low-temperature induction and potato block technology, which is applied in DNA preparation, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of low low-temperature induction activity, accumulation of reducing sugar in tubers, prolonging the processing time of potato tubers, etc. activity, increased expression activity, and small sequence differences
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0012] Example 1 Construction of fusion promoter pCLdb
[0013] The concrete method that the present invention obtains fusion promoter pCLdb is as follows:
[0014] Based on the pCL promoter, the base mutation of the CRT / DRE flanking sequence and the repetition of the CRT / DRE element are introduced into it, and the required base modification is introduced into pCL by introducing an overlap extension sequence in the primer, and the overlap extension PCR The primers used in the procedure are as follows:
[0015] Table 1 The sequences of the PCR primers used
[0016] name
sequence
ZL01L
TCCAAGCTTATTGAGAACGACCCT
M1b
AGAGGTCGGCCATCAAGTGATCG
M1b
GATCACTTGATGGCCGACCTCTTTTTT
M2B
AAGAGGTCGGCCATCAAGTGATCGAAGAAGAA
M2B
GATCACTTGATGGCCGACCTCTTTTTTCTGAAAACC
ZC01R
CGCGGATCCATTTTGTTGGTGCTT
[0017] First, two fragments b1L and b1R were amplified from the pCL promoter by using Pyrobest enzyme, and the PCR p...
Embodiment 2
[0034] Example 2: Construction of mutant fusion promoter and plant expression vector
[0035] pCLdb was double digested with HindIII and BamHI, and then cloned into the corresponding site of plasmid pUC18 to obtain recombinant plasmid pCLdb-18. Plasmid pCLdb-19 was double-digested with restriction endonucleases HindIII and BamHI, and the corresponding promoter fragments were respectively recovered and ligated with the large vector fragment recovered from pBI121 plasmid by double-digestion of HindIII and BamHI. Take 10 μL of ligation products to transform Escherichia coli DH5α competent cells respectively. After the transformants grew into colonies, a single colony was picked to prepare a small amount of plasmid DNA, which was identified by enzyme digestion with HindIII and BamHI, and the resulting recombinant plasmid was named pCLdb-121. The obtained recombinant plasmid was directly introduced into Agrobacterium LBA4404 for plant transformation.
Embodiment 3
[0036] Example 3: Potato transformation and detection of GUS expression activity
[0037]Potato Transformation: The plant expression vector was transformed into Agrobacterium LBA4404. Potatoes were transformed by the test-tube potato slice method in MS medium containing kanamycin and cephalosporin (MS basic medium + 3% sucrose + 1 mg / L IAA + 0.2 mg / L GA3 + 0.5 mg / L BA + 2 mg / L ZT + 75 mg / L Km + 400 mg / L Cef, pH 5.8) to select resistant plants; then transfer them to rooting medium (MS minimal medium + 50 mg / L Km + 200 mg / L Cef, pH5.8) to take root, and then reproduced by tissue culture; when the plant grows to about 30 days, select the leaves of the plant with normal growth, and use the CTAB method to extract the plant genomic DNA; using the genomic DNA as a template, by PCR Methods To detect the integration of exogenous genes, the primers used in PCR are promoter vector-specific primers P-Hind3 (ACCATGATTACGCCAAGCTT) and P-BamHI (GACTGACCACCCGGGGATCC), which can specifically...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com