Cotton stearyl desaturase gene GbSSI2 and application thereof

A stearoyl and gene technology is applied to the cloning of cotton stearoyl desaturase gene GbSSI2, the application field in controlling cotton's resistance to verticillium wilt, and can solve the problems of lack of jasmonic acid synthesis regulation research and the like

Inactive Publication Date: 2015-03-04
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the regulation of jasmonic acid synthesis in cotton

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton stearyl desaturase gene GbSSI2 and application thereof
  • Cotton stearyl desaturase gene GbSSI2 and application thereof
  • Cotton stearyl desaturase gene GbSSI2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1: GbSSI2 gene isolation clone

[0038] 1. Expression Analysis

[0039] The previous work of the applicant of the present invention was to study the differential expression of proteins in the roots of sea-island cotton 'Hai 7124' after being inoculated with Verticillium dahliae, and found a protein spot whose expression changed significantly after being inoculated with Verticillium dahliae ( figure 2 A), a gene was identified by this protein spot by tandem mass spectrometry analysis, and semi-quantitative PCR (RT-PCR) was used to identify the gene. 'Hai 7124' showed an up-regulation pattern compared to the water-receiving control ( figure 2B). The total protein of cotton roots inoculated with Verticillium dahliae was extracted from the sea-island cotton line 'Hai 7124', and the extraction method was TCA / acetone combined with phenol extraction (Yao, Y., Yang, Y.W., Liu J.Y.2006, An efficient protein preparation for Proteomic analysis of developing cotton fi...

Embodiment 2

[0056] Example 2: Expression Analysis of GbSSI2 Gene in Different Tissues of Cotton and Response to Plant Resistance Signaling Molecules

[0057] Using sea island cotton 'Hai 7124' as material, extract the RNA of 8 different tissues including root, stem, cotyledon, true leaf, fiber, ovule, petal and anther (see Example 1 for the extraction method and RNA reverse transcription method), and use RT-PCR method was used to detect the expression level of GbSSI2 gene. Using the cDNA synthesized by the above reverse transcription as a template, the gene GbSSI2 obtained in Example 1 was used to design specific primers GbSSI2Rt-s (5'CGCCACGAGACAGCATACACTAA 3') and GbSSI2Rt-a (5'CAGAAACCCAACTGAATGGAACAC 3') to carry out PCR amplification of the GbSSI2 gene increase. At the same time, primers UB7-s (5'GAAGGCATTCCACCTGACCAAC3') and UB7-a (5'CTTGACCTTTCTTCTTCTTGTGCTTG3') were used to specifically amplify the cotton GhUbi7 (GenBank accession number: DQ116441) gene as an internal control for...

Embodiment 3

[0059] Example 3: Construction of virus interference vector, RNAi suppression expression vector and overexpression vector and transformation mediated by VIGS

[0060] The specific method of VIGS-mediated cotton plant transformation is as follows: the Agrobacterium strain with pTRV:RNA1, pTRV:RNA2 and pTRV2:GbSSI2 was treated with 50 μg / mL Kanamycin (Kanamycin, purchased from Sigma, the U.S.) Activation on LB dishes. Two days before inoculation, pick a single clone and inoculate it in 5ml LB culture medium. Add 50 μg / mL Kanamycin (Kanamycin) to the LB culture medium. overnight on a shaker at 28°C with a rotational speed of 50 rpm. Inoculate the activated bacterial solution into 100ml of Kanamycin LB culture solution containing 50μg / mL, and add 10mM 4-morpholinoethanesulfonic acid, referred to as MES (2-(4morpholino)-ethanesulfonic acid), 20μM acetosyringone . overnight at 28°C on a shaker at 50 rpm. When the concentration of Agrobacterium OD 600 =0.8 or so, the bacterial ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cotton stearyl desaturase gene GbSSI2 and application thereof. The invention belongs to the technical field of plant genetic engineering and particularly relates to the isolation, cloning, functional verification and application of the gene GbSSI2 identified in gossypium barbadense. The cDNA sequence of the gene GbSSI2 is shown as SEQ ID NO:1; the amino acid sequence of the protein of the encoding gene of the gene GbSSI2 is shown as SEQ ID NO:2. The functional verification shows that the gene GbSSI2 has the functions of regulating and controlling the synthesis of relevant disease-resistant endogenous hormones in cotton, such as salicylic acid and jasmonic acid, and can be applied to the cultivation of the anti-verticillium dahliea cotton strains through genetic transformation.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to the cloning of a cotton stearoyl desaturase gene GbSSI2 and its application in controlling cotton resistance to Verticillium wilt. The present invention adopts the method of comparative proteomics, and through the analysis of the protein profile of the cotton Verticillium wilt resistance response gene, the isolated and cloned GbSSI2 gene is a gene that regulates the synthesis and response of the cotton disease resistance-related hormones salicylic acid and jasmonic acid. Can affect the resistance of cotton to Verticillium wilt. Background technique [0002] Cotton verticillium wilt is an uploaded fungal vascular disease through root infection. After infection by pathogenic bacteria, it will cause cotton leaves to turn green and yellow, wilt and fall off, and often cause plant death in serious cases, seriously threatening cotton production and fiber quality. Co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/53C12N15/82C12N15/84A01H5/00
Inventor朱龙付高巍龙璐张献龙袁道军聂以春
OwnerHUAZHONG AGRI UNIV