Cotton stearyl desaturase gene GbSSI2 and application thereof
A stearoyl and gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem of no jasmonic acid synthesis regulation research and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1: GbSSI2 gene isolation clone
[0038] 1. Expression Analysis
[0039] The previous work of the applicant of the present invention was to study the differential expression of proteins in the roots of sea-island cotton 'Hai 7124' after being inoculated with Verticillium dahliae, and found a protein spot whose expression changed significantly after being inoculated with Verticillium dahliae ( figure 2 A), a gene was identified by this protein spot by tandem mass spectrometry analysis, and semi-quantitative PCR (RT-PCR) was used to identify the gene. 'Hai 7124' showed an up-regulation pattern compared to the water-receiving control ( figure 2B). The total protein of cotton roots inoculated with Verticillium dahliae was extracted from the sea-island cotton line 'Hai 7124', and the extraction method was TCA / acetone combined with phenol extraction (Yao, Y., Yang, Y.W., Liu J.Y.2006, An efficient protein preparation for Proteomic analysis of developing cotton fi...
Embodiment 2
[0056] Example 2: Expression Analysis of GbSSI2 Gene in Different Cotton Tissues and Response to Plant Resistance Signaling Molecules
[0057] Using sea island cotton 'Hai 7124' as material, extract the RNA of 8 different tissues including root, stem, cotyledon, true leaf, fiber, ovule, petal and anther (see Example 1 for the extraction method and RNA reverse transcription method), and use RT-PCR method was used to detect the expression level of GbSSI2 gene. Using the cDNA synthesized by the above reverse transcription as a template, the gene GbSSI2 obtained in Example 1 was used to design specific primers GbSSI2Rt-s (5'CGCCACGAGACAGCATACACTAA 3') and GbSSI2Rt-a (5'CAGAAACCCAACTGAATGGAACAC 3') to carry out PCR amplification of the GbSSI2 gene increase. At the same time, primers UB7-s (5'GAAGGCATTCCACCTGACCAAC3') and UB7-a (5'CTTGACCTTTCTTCTTCTTGTGCTTG3') were used to specifically amplify the cotton GhUbi7 (GenBank accession number: DQ116441) gene as an internal control for re...
Embodiment 3
[0059] Example 3: Construction of virus interference vector, RNAi suppression expression vector and overexpression vector and transformation mediated by VIGS
[0060] The specific method of VIGS-mediated cotton plant transformation is as follows: the Agrobacterium strain with pTRV:RNA1, pTRV:RNA2 and pTRV2:GbSSI2 was treated with 50 μg / mL Kanamycin (Kanamycin, purchased from Sigma, the U.S.) Activation on LB dishes. Two days before inoculation, pick a single clone and inoculate it in 5ml LB culture medium. Add 50 μg / mL Kanamycin (Kanamycin) to the LB culture medium. overnight on a shaker at 28°C with a rotational speed of 50 rpm. Inoculate the activated bacterial solution into 100ml of Kanamycin LB culture solution containing 50μg / mL, and add 10mM 4-morpholinoethanesulfonic acid, referred to as MES (2-(4morpholino)-ethanesulfonic acid), 20μM acetosyringone . overnight at 28°C on a shaker at 50 rpm. When the concentration of Agrobacterium OD 600 =0.8 or so, the bacterial ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap