Cotton cytochrome P450 gene and application
A technology of cytochrome and cotton, which is applied in the field of plant genetic engineering, can solve the problems of low gene homology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1: GhSSN gene isolation clone
[0050] 1. Expression Analysis
[0051] The previous work of the applicant of the present invention was to study the differences in gene expression in the roots of sea-island cotton 'Hai 7124' after being inoculated with Verticillium dahliae, and found a gene whose expression changed significantly after being inoculated with Verticillium dahliae through analysis. Real-time quantitative PCR identification showed that the expression pattern of this gene was significantly different after inoculation of Verticillium dahliae 'V991' between the resistant sea-island cotton 'Hai 7124' and the susceptible upland cotton 'YZ-1' (see figure 1 B. figure 1 C). Total RNA was extracted from cotton roots inoculated with Verticillium dahliae from the upland cotton line 'YZ-1' (the extraction method was based on Zhu et al., An improved simple protocol for isolation of high quality RNA from Gossypium spp.suitable for cDNA library construction, A...
Embodiment 2
[0054] Example 2: GhSSN expression analysis in different tissues of cotton and response to plant disease resistance signaling molecules
[0055] Using upland cotton 'YZ-1' as material, RNA was extracted from the following three different tissues, and Real-time PCR was used to detect the expression level of GhSSN gene. The three selected tissues are: 1. Root; 2. Stem; 3. Leaf. Cotton total RNA extraction method is according to the literature published by Zhu et al. (An improved simple protocol for isolation of high quality RNA from Gossypium spp. suitable for cDNA library construction. Acta Agronomica Sinica. Afterwards, it was treated with DNaseI (purchased from Promega), and the RNA integrity was detected by 1.2% (w / v) agarose gel (EtBr) electrophoresis (5V / cm). The nucleic acid concentration was measured on a Beckman DU800spectr photometer (Beckman, USA). The RNA 260 / 280 ratio was between 1.9 and 2.1, and the RNA with a 260 / 230 ratio greater than 2.0 was used for the next ...
Embodiment 3
[0057] Example 3: Construction and Transformation of Overexpression Vectors and RNAi Inhibition Expression Vectors
[0058] In order to verify the function of the GhSSN gene, the applicant constructed an overexpression and RNAi suppression expression vector to transform cotton.
[0059] Design overexpression primers according to the GhSSN obtained in Example 1, add attB site sequences and protective bases for recombination at both ends of the primers, that is, add 5' GGGGACAAGTTTGT ACAAAAAAGCAGGCTGC 3' linker at the 5' end of the sense primer, and antisense A 5' GGGGACCACTTTGTA CAAGAAAGCTGGGTG3' linker was added to the 5' end of the primer, and the primers were named GhSSNoe-F (5'GGGGAC AAGTTTGTACAAAAAGCAGGCTGCATTCTCTACACTTTCTTAACACAGCA G3') and GhSSNoe-R (5'GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCTGT CCTTCGCCACTTTAT) respectively. Then use the cDNA of the GhSSN gene as a template for PCR amplification, and the obtained PCR product is constructed on the intermediate vector pDNOR221 (...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap