Cotton homologous structure field transcription factor gene GbHDTF1 and and application thereof

A technology of homeodomain and transcription factor is applied to the cloning of cotton homeodomain transcription factor gene GbHDTF1 to control the application field of cotton verticillium wilt, and can solve the problem that the detailed regulatory network is not very clear and so on.

Inactive Publication Date: 2015-04-22
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although many jasmonic acid-related genes have been cloned in Arabidopsis and rice, the jasmonic acid synthesis and its detailed regulatory network are still not very clear for cotton

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton homologous structure field transcription factor gene GbHDTF1 and and application thereof
  • Cotton homologous structure field transcription factor gene GbHDTF1 and and application thereof
  • Cotton homologous structure field transcription factor gene GbHDTF1 and and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: GbHDTF1 gene isolation and clone

[0035] The preliminary work of the applicant of the present invention is to study the transcriptome sequencing data of the roots of sea island cotton 'Hai 7124' (China Cotton Germplasm Bank, Beijing, Chinese Academy of Agricultural Sciences, Institute of Crop Variety Resources) after inoculation with Verticillium wilt. Down-regulated genes after Verticillium wilt.

[0036] Use the obtained EST sequence to perform sequence alignment in the cotton D genome database (http: / / www.phytozome.net / cotton.php) to obtain a candidate DNA sequence matching the gene, and use the DNA sequence as a template to design primers GbHDTF1-OE-F (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGCTTCTGCTTTGTCAGT3') and GbHDTF1-OE-R (5'GGGGACCACTTTGTACAAGAAAGCTGGGTCACATTGTCATCCCTAAACAGTAAAC3'), the DNA, cDNA and ORF sequences of GbHDTF1 were amplified from the total DNA and cDNA of sea island cotton 'Hai 7124', respectively. A cotton homology domain transcripti...

Embodiment 2

[0038] Example 2: Expression analysis of GbHDTF1 in different cotton tissues and its response to plant disease resistance signaling molecules

[0039] Using sea island cotton 'Hai 7124' as the material, RNA was extracted from eight different tissues of roots, stems, cotyledons, true leaves, fibers, ovules, petals and anthers. protocol for isolation of high quality RNA from Gossypium spp.suitable for cDNA library construction.Acta Agronomica Sinica.2005,31:1657-1659). After RNA extraction was completed, it was treated with DNaseI (purchased from Promega), and the RNA integrity was detected by 1.2% (w / v) agarose gel (EtBr) electrophoresis (5V / cm). The determination of nucleic acid concentration was carried out on a Beckman DU800 spectrophotometer (purchased from Beckman, USA). RNAs with a 260 / 280 ratio between 1.9 and 2.1, and RNAs with a 260 / 230 ratio greater than 2.0 were used for further analysis. The expression level of GbHDTF1 gene was detected by RT-PCR. cDNA synthesis ...

Embodiment 3

[0042] Example 3: Construction of viral interference vector, RNAi inhibitory expression vector and overexpression vector and VIGS-mediated transformation

[0043] The following primers were designed according to the gene sequence of GbHDTF1: forward primer GbHDTF1-trv-s (5'CGACGACAAGACCCTGGCGAGGAAGACGGCAACGAC3'), reverse primer GbHDTF1-trv-a (5'GAGGAGAAGAGCCCTATGTTTGGTTTCAGGCATTGGT3'), and then PCR amplification was performed using GbHDTF1 gene cDNA as template The resulting product and pTRV:RNA2 vector (a gift from Dr. Thomma, Wageningen University, The Netherlands) were double-enzyme digested with restriction enzymes BamH1 and Kpn1 (purchased from NEB, China). The PCR product after digestion was connected with the pTRV:RNA2 plasmid fragment recovered by digestion with T4 ligase (purchased from Invitrogen, USA), and the ligation product was the viral silencing vector pTRV2-GbHDTF1 (see image 3 A) ( Figure 4 A), the vector was subjected to heat shock transformation (operate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cotton homologous structure field transcription factor gene GbHDTF1 and application thereof. The invention belongs to the field of plant gene engineering, and relates to a gene GbHDTF1 which is separated from sea island cotton and used for regulating synthesis and response of cotton endogenous disease-resistance related hormone jasmonic acid. The cDNA (complementary deoxyribonucleic acid) sequence of the gene is disclosed as SEQ ID NO:1, and the sequence of the coded protein is disclosed as SEQ ID NO:2. The invention also relates to an expression vector containing the gene disclosed as SEQ ID NO.1, expression of a double-chain nucleic acid molecule formed by the nucleic acid sequence and application to inhibiting expression of the cotton endogenous gene GbHDTF1 to promote synthesis and response of the jasmonic acid. The invention provides a host cell containing the expression vector, which comprises Escherichia coli and agrobacterium. The GbHDTF1 gene has the function of regulating synthesis and response of the cotton endogenous disease-resistance related hormone jasmonic acid, and can be used for cultivating a novel anti-greensickness cotton material through genetic transformation.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to the cloning of a cotton homology domain transcription factor gene GbHDTF1 and its application in controlling cotton verticillium wilt. The present invention adopts the method of transcriptome sequencing to analyze the transcriptome of genes related to cotton resistance to verticillium wilt, and the isolated and cloned GbHDTF1 gene is a gene that regulates the synthesis and response of cotton disease resistance-related hormone jasmonic acid, and can affect cotton's response to verticillium wilt disease resistance. Background technique [0002] Cotton verticillium wilt, known as the "cancer" of cotton, is a soil-borne fungal vascular disease caused by Verticillium dahliae and Verticillium black and white. Pathogens infect cotton roots, causing leaves to turn yellow, wilt, and even cause plant death, seriously threatening cotton yield and fiber quality. After co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00
Inventor朱龙付张献龙高巍龙璐
OwnerHUAZHONG AGRI UNIV