Primer pair and reagent kit for detecting coccinella septempunctata, and detection method thereof
A technology of seven-spot ladybug and primer pair, which is applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve the problem of no detection method for seven-spot ladybug, and achieve rapid sensitivity and high sensitivity , the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1 detection primer CsF6 / R6 is to the amplification effect of seven-star ladybug
[0024] (1) Preparation of ladybug template DNA
[0025] Put the single-headed ladybug into a 1.5ml centrifuge tube and grind it, and use the TIANamp Genomic DNA Kit Blood / Cell / Tissue Genomic DNA Extraction Kit (Spin Column Type) (Tiangen Bio (Beijing) Co., Ltd.) to extract the single-headed ladybug The ladybug genome.
[0026] (2) Synthesize and test the specific COI primers of Ladybug
[0027] The primer pair of the present invention is designed by comparing the gene sequences of different ladybug mitochondrial cytochrome oxidase I subunits (cytochrome oxidase subunit I, COI) amplified by the universal primer pair LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA).
[0028] Design the specific COI primer pair for testing the seven-star ladybug:
[0029] Primer CsF6:5'-AATATACGACCATTTGGC-3'
[0030] Primer CsR6:5'-TTGATAAAGGATGGGATCT-3'
[0031] (3) Pe...
Embodiment 2
[0043] Example 2 Primer CsF6 / CsR6 Determination of the Minimum Detection Amount of Coccinella chinensis
[0044] (1) Preparation of template DNA of Ladybug seven-star ladybug
[0045] According to Example 1, the genomic DNA of a single ladybird adult beetle was extracted. Then the original template solution was serially diluted by 2 times until no bands could be detected, and 1 μL was used as the template for PCR amplification, which was directly added to the PCR reaction system.
[0046] (2) Synthesize and test the specific COI primers of Ladybug, the nucleotide sequences of which are the same as those in Example 1.
[0047] (3) Perform PCR amplification reaction, the reaction system and PCR amplification procedure are the same as in Example 1.
[0048] (4) To identify the PCR product, the identification method is the same as in Example 1.
[0049] (5) Implementation Results
[0050] Use the primer CsF6 / CsR6 to determine the minimum detection amount, and use the seven-spo...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap