Unlock instant, AI-driven research and patent intelligence for your innovation.
slc25a13 gene mutant and its application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A mutant and nucleic acid technology, applied in the field of biological sample kits, can solve the problem of NICCD disease that needs to be further developed
Active Publication Date: 2017-12-19
BGI GENOMICS CO LTD
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0003] Therefore, the current research on NICCD disease still needs to be in-depth
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0053] Example 1 Target region capture sequencing to determine the mutation site
[0054] Sample collection:
[0055] The peripheral blood of half-year-old girls who were clinically suspected of having tyrosinemia, galactosemia or Citrin deficiency syndrome, their parents and uncles were collected and extracted using the QIAamp DNA BloodMiNi Kit (Qiagen, Hilden, Germany). Genomic DNA was used as a sample. Among them, the patient's clinical manifestations were: severe yellow staining of the skin all over the body, no dullness in color, and no other symptoms, normal expression and mental performance, moderate yellow staining of the sclera, slightly distended abdomen, about 2.5 cm in the right lower rib of the liver, mass Soft, about 2 cm below the left rib of the spleen, medium in quality. Laboratory tests: bile acid, total bilirubin, direct bilirubin, indirect bilirubin increased, albumin, globulin decreased. Clinically, the patient was suspected of having tyrosinemia, galac...
Embodiment 2
[0067] Example 2 Sanger method sequencing verification
[0068] Using the genomic DNA samples of the patient and his parents and uncle collected in Example 1 (the patient's parents and uncle are non-NICCD disease patients), the SLC25A13 gene mutation site of the patient obtained above was verified by Sanger sequencing according to the following steps:
[0069] 2.1 Primer design and PCR reaction
[0070] First, refer to the human genome sequence database hg19 / build36.3, and design the following specific primers for the mutation site of the SLC25A13 gene:
[0071] c.754G>A mutation site primer sequence
[0072] Forward primer: ATTCGCTCCTTAACAACATGGAACTCA (SEQ ID NO: 3);
[0073] Reverse primer: CAAACTGCTGGGATTTCAGGTGTGA (SEQ ID NO: 4),
[0074] c.1177+1G>A mutation site primer sequence
[0075] Forward primer: CTGTTGGAGCCACTGCTGTGTATC (SEQ ID NO: 5);
[0076] Reverse primer: CTTGCTAATTCATGTCAGGCACTAAGATG (SEQ ID NO: 6).
[0077] Therefore, using the above SLC25A13 gene mut...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The present invention relates to isolated nucleic acids encoding SLC25A13 mutants, isolated polypeptides, methods for screening biological samples susceptible to NICCD diseases, systems for screening biological samples susceptible to NICCD diseases, and reagents for screening biological samples susceptible to NICCD diseases box. Wherein, compared with SEQ ID NO:1, the isolated nucleic acid encoding the SLC25A13 mutant has at least one mutation selected from the group consisting of c.754G>A and c.1177+1G>A. By detecting whether these new mutants exist in biological samples, it is possible to effectively detect whether biological samples are susceptible to NICCD disease.
Description
technical field [0001] The present invention relates to SLC25A13 gene mutant and application thereof. In particular, the present invention relates to isolated nucleic acids encoding SLC25A13 mutants, isolated polypeptides, methods of screening biological samples for susceptible neonatal citrullinemia type 2 disease, screening for susceptible neonatal citrullinemia type 2 A system for biological samples of disease and a kit for screening biological samples for predisposing neonatal citrullinemia type 2 disease. Background technique [0002] Neonatal citrullineemia type 2 (phaeohyphomycosis, OMIM No. 605814), also known as neonatal citrin deficiency-induced intrahepatic cholestasis (Neonatal Intrahepatic Cho lestasis Caused By CtrinDeficiency, NICCD), which belongs to amino acid metabolism deficiency It is a kind of citrulline metabolism disease. Patients will develop cholestatic jaundice, abnormal liver function, and various symptoms of hyperaminoacidemia, galactosemia and f...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More