Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for rapidly diagnosing shrunken-fruitsclerotiniose of mulberry

A technology for rapid diagnosis and sclerotinia, applied in the field of plant disease prevention and control, to achieve accurate and reliable detection results, high sensitivity, and convenient and quick use

Inactive Publication Date: 2015-04-15
SOUTHWEST UNIVERSITY
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there are no research reports on the discovery of the specific conserved DNA sequence (or gene) of G. nucleatum and the rapid molecular diagnosis and identification method of the reduced Sclerotinia sclerotiorum at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly diagnosing shrunken-fruitsclerotiniose of mulberry
  • Method for rapidly diagnosing shrunken-fruitsclerotiniose of mulberry
  • Method for rapidly diagnosing shrunken-fruitsclerotiniose of mulberry

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: the extraction of testing material DNA . The aforementioned test strains were inoculated on the PDA medium with cellophane, Sclerotinia, Botrytis cinerea and Trichoderma were cultured in the dark at 20°C for 2 days, and the pathogenic bacteria of Sclerotinia mulberry were cultured in the dark at 25°C for 15 days and the mycelia were collected. Using the CTAB method (( Liu Li, Zhang Yongjun, Xu Changzheng, Luo Feng. An improved CTAB method for DNA extraction of polysaccharide-producing fungi. Chinese Journal of Biotechnology, 2014, 34(5): 75-79 ) to extract the genomic DNA of plant tissues such as fungus and mulberry, and the soil samples refer to Woodhall et al. ( Woodhall J W, Webb K M, Giltrap P M, Adams I P, Peters J C, Budge G E, Boonham N. A new large scale soil DNA extraction procedure and real-time PCR assay for the detection of Sclerotium cepivorum in soil. European Journal of Plant Pathology, 2012, 134(3): 467-473 ), the concentration and qual...

Embodiment 2

[0026] Example 2: Acquisition of specific conserved fragments of DNA of G. nuclei. First, RAPD (random amplified polymorphism DNA)-PCR technology was used to amplify and screen out the specific conserved DNA fragment sequence of G. nucleatum. The 40 random primers used were synthesized by Shanghai Sangong. Referring to Williams et al. ( Williams J G K, Kubelik A R, Liv S ak K J, Rafalski J A,Tingey V. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research, 1990, 18(22): 6531-6535 ), the total volume of each RAPD amplification reaction PCR is 25 μL, including 2.5 μL 10×PCR Buffer; 1.5 μL Mg 2+ (25mmol / L); 2μL dNTPs (2.5mmol / L); 1μL 10mM random primer, 1μL DNA template, 0.25μL rTaq enzyme (2.5U / μL); 2 O make up. The amplification program was as follows: pre-deformation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 36°C for 30 s, extension at 72°C for 1.5 min, 35 cycles; final extension at 72°C for 10 min and s...

Embodiment 3

[0030] Example 3: SCAR specific primer design and screening . According to the sequence of the specific fragment, 20 pairs of SCAR primers were designed with Premier 5.0 software, and the designed primer pairs were synthesized by Shanghai Sangon Biotechnology Co., Ltd. These 20 pairs of primers were screened by PCR, and a pair of best specific primers SS-F / SS-R were screened from these primers. The forward sequence SS-F of the primer is 5'- AGTAAAGAGAACATCAAACTTCG -3', located at 8 bp-30 bp of the specific sequence; the reverse sequence SS-R is 5'- ACTTCC ACCGACCA ATCT -3', located at 580bp-596bp of the specific sequence , the target fragment is 590 bp (see the underlined part in the sequence listing).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly diagnosing shrunken-fruitsclerotiniose of mulberry. Through the discovered pathogen scleromitrula shiraiana specificity conserved DNA sequence, a specificity SCAR-PCR primer is obtained and a shrunken-fruitsclerotiniose of mulberry SCAR-PCR diagnosis and detection method is established. The method is high in sensitivity (the detection sensitivity is 1pg / [mu]L, high in specificity, convenient and rapid to use and accurate and reliable in detection result, can be used for the field diagnosis of the shrunken-fruitsclerotiniose of mulberry and the detection of the mulberry bacteria carrying condition, and also can be used for the diagnosis of the disease incubation period (the mulberries are infected but the symptoms do not appear) so as to forecasting the diseases in an early stage, take necessary control measures in time, safely and effectively prevent and control the disease and lighten or avoid the economic loss. According to the method, the product such as a detection kit for the shrunken-fruitsclerotiniose of mulberry can be researched and developed; the method is widely applied to the scientific research and production practice of the industries related to mulberries.

Description

technical field [0001] The invention relates to the technical field of plant disease prevention and control, in particular to a method for rapidly diagnosing mulberry miniature sclerotinia by using molecular biology technology. Background technique [0002] The economic importance of shrunken-fruitsclerotiniose of mulberry. Shrunken-fruitsclerotiniose of mulberry is one of three sclerotiniasis of mulberry, and its pathogen is Sclerotinia sclerotiorum ( Scleromitrula shiraiana ) ( Schuamacher T, Holst-Jensen A. A synopsis of the genus Scleromitrula. Mycoscience, 1997, 38(1): 55-69 ), is the most common and most harmful sclerotinia in the world. The disease is very common in my country. It occurs in major fruit and mulberry planting areas such as Jiangsu, Zhejiang, Shanghai, Sichuan, Chongqing, Shaanxi and Taiwan. %; In recent years, the outbreak of Sclerotinia sclerotiorum in many areas has caused a large area of ​​fruit and mulberry production to be destroyed ( Kuai Yuan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
CPCC12Q1/686C12Q1/6895C12Q2535/139
Inventor 谭万忠吴舒劼苏正川余洋毕朝位杨宇衡
Owner SOUTHWEST UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More