9 results about "Soil dna" patented technology

The invention discloses a method for rapidly separating and screening soil bacteriophages, and belongs to the field of microbial technology. The method comprises the following steps: mixing a soil sample with an SM buffer solution, adding a CaCl2 solution and an LB solution, and carrying out enrichment culture on a plurality of logarithmic phase host bacteria; centrifuging, taking supernatant and filtering to obtain phage suspension; primarily screening plaque through a spot method or a double-layer plate method, and carrying out multiple rounds of gradient dilution and purification to obtain a single phage; eluting the amplified plaque by using an SM buffer solution, and filtering to obtain a phage stock solution; adding a ferric chloride solution to the stock solution to precipitate bacteriophages, centrifuging, and oscillating and releasing with an ascorbic acid mixed solution; dNase I and a buffer solution are added to digest free nucleic acid, and after the reaction is terminated, a soil DNA extraction kit is utilized to obtain bacteriophage genome DNA.

The invention discloses a micro-plastic soil ecological risk assessment method and device, a medium and a product, and relates to the field of micro-plastic soil ecological effect assessment.The method comprises the steps that sampling is conducted in a to-be-assessed sample plot, and biological repeated samples are obtained; the method comprises the following steps: treating a biological repeated sample by using a co-extraction method to obtain total DNA of soil; performing high-throughput sequencing of amplicon genes on the total DNA of the soil to obtain original data; preprocessing the original data, and constructing a species abundance matrix; constructing a transboundary co-occurrence network according to the species abundance matrix; respectively calculating a first network topology index and a second network topology index; and according to the first network topology index and the second network topology index, determining a comprehensive ecological effect index of the to-be-evaluated sample plot by using a comprehensive ecological effect index determination model so as to evaluate the micro-plastic soil ecological risk. According to the invention, the integrity and accuracy of micro-plastic soil ecological risk assessment are improved.

This invention discloses a primer set for PCR detection of *Sclerotium rigescens*, along with its detection method and application, belonging to the field of microbial detection technology. The primer set includes primers SR-F and SR-R, with the following specific primer sequences: SR-F: TTCGTGGGGTGCTAAGGGAGT; SR-R: TTGTCGTGTCAGCGGGGAGAG. Detection method: (1) Collect rhizosphere soil samples from economic crops and extract total soil DNA; (2) Use the total soil DNA as a template for PCR amplification using the primer set; (3) Perform nucleic acid electrophoresis on the amplified products. If a specific amplification band of 361 bp is detected in the soil sample, it indicates the presence of *Sclerotium rigescens* in the soil sample. The primer set and detection method of this invention have high sensitivity and specificity, allowing direct detection of *Sclerotium rigescens* from soil samples without pure culture. The identification time is shortened from 3-5 days to 2-3 hours, making it suitable for early disease monitoring and control in the field.

The invention relates to a pretreatment method for extracting soil DNA and a method for extracting soil DNA, the method comprises the following steps: S0, mixing a soil sample, CTAB lysate and glass beads in a centrifuge tube to obtain a mixed solution, enabling a grinding pestle of a handheld grinder to be in contact with the mixed solution in the centrifuge tube, and performing grinding treatment to obtain a ground mixed solution; carrying out cracking treatment on the ground mixed solution to obtain a cracking solution; wherein the concentration of the CTAB lysate is more than 3.5%; the particle size of the glass beads is 0.25 to 0.35 mm; the rotating speed of the grinding treatment is 10000 to 12000 rpm, and the time is 40 to 50 seconds; the cracking treatment comprises the following steps: the cracking temperature is 60-70 DEG C; the cracking treatment time is 9 to 12 minutes; the centrifugal tube is subjected to reversing operation at intervals of multiple times, the interval time of every two adjacent reversing operations is 2-4 min, and the duration time of each reversing operation is 20-40 s. The method provided by the invention can efficiently, conveniently and quickly complete DNA extraction at low cost, and meanwhile, the DNA is high in yield, high in purity, high in concentration and good in integrity.

The invention provides an ultra-fast soil DNA extraction method and application thereof. The method comprises the following steps: S1, sample pretreatment: taking 50 mg of a soil sample, putting the soil sample in a 200 [mu] L ultrasonic tube, adding 20 mg of a reagent A and 50 [mu] L of Buffer A, carrying out full and uniform vortex mixing, putting the mixture in an ultrasonic instrument, setting the water temperature at 37 DEG C, and carrying out focused ultrasound for 2 minutes; s2, extraction of soil DNA: transferring the pretreated sample into a 2 mL ultrasonic tube, adding 450 [mu] L of Buffer B, carrying out vortex mixing, adding 20 [mu] L of Buffer C, carrying out uniform mixing, placing the mixture in an ultrasonic instrument, setting the water temperature at 37 DEG C, and carrying out focused ultrasound for 2-5 min; s3, purification of the soil DNA: after the ultrasonic treatment is finished, taking out the ultrasonic tube, transferring all the solution subjected to the ultrasonic treatment into a 2mL centrifugal tube, and centrifuging for 5-10 minutes at the temperature of 4 DEG C and 12000g to obtain supernate, namely a soil DNA solution. The soil DNA extraction method disclosed by the invention is short in time, low in cost, simple in operation steps, suitable for various types of soil samples, and very suitable for popularization, and the whole experiment process does not exceed 30 minutes.

The invention discloses a method for improving biological aerosol sampling efficiency, and relates to a biological aerosol collection technology in the field of environmental science, and the method comprises the following steps: (1) using a quartz glass fiber filter membrane (the size is 250 mm * 230 mm, and the aperture is 2.2 [mu] m) to cooperate with an air sampler to collect microbial particles; (2) physically stripping substances on the surface layer of the hair surface of the filter membrane by adopting an ultraviolet sterilized polyethylene glycol terephthalate (PET) hard brush (the length of brush hair is 2.85-3.15 cm), and collecting microorganisms; and (3) extracting DNA through a soil DNA kit, and combining fluorescence quantification and agarose gel electrophoresis detection. According to the method, a quartz film rough surface-supporting surface layered structure is creatively utilized, efficient collection of microbial particles is achieved through physical stripping, the limitation of a traditional chemical elution method is overcome, and the DNA recovery rate and the operation efficiency are remarkably improved; the sampling efficiency is superior to that of a mixed cellulose ester filter membrane, and the cost benefit and the adaptability of a high-flow sampler are both considered. The method can be widely applied to the fields of environmental monitoring and public health.

The application discloses a kind of microorganism culture scheme customization recommendation method and system based on soil data analysis, it is related to microorganism culture scheme technical field, this method includes: by collecting different positions and depth of soil sample, analysis soil characteristic data and carry out data processing;Through soil DNA extraction, PCR amplification and high-throughput sequencing obtain microbial community information, combine data preprocessing and diversity analysis, assess microorganism distribution and function;According to soil characteristics and microbial community analysis result, select suitable microorganism strain;Microorganism culture scheme is combined with agricultural management measure;Through real-time monitoring soil and microorganism condition, based on feedback mechanism dynamically adjusts microorganism culture scheme;Through field test and advanced performance evaluation index, the effect of microorganism culture scheme is verified for a long time.The application has strong adaptability and sustainability, and can provide customized microorganism management scheme in different agricultural environments.

The invention provides a magnetic bead method soil DNA extraction kit, and belongs to the technical field of molecular biology. The kit comprises protease K, a lysis buffer solution, a lysis strengthening solution, a precipitation solution, a lysis solution, a washing solution 1, a washing solution 2, a washing solution 3, an eluent and magnetic beads, according to the kit, DNA in soil can be rapidly extracted and purified, the extraction efficiency of pathogenic microorganism nucleic acid is improved, meanwhile, components in the kit can still keep the original activity and efficacy after long-term storage, and therefore the accuracy and reliability of experimental results are ensured, and a new thought is provided for extraction of the DNA in the soil.

The invention discloses a method for detecting rhizosphere and non-rhizosphere microbial communities of bluegrass based on a metagenome technology, and relates to the technical field of molecular biology, and the method comprises the following steps: (1) sample collection, (2) soil DNA extraction: circularly grinding a sample through freezing-pyrolysis, cracking with a CTAB buffer solution at 65 DEG C, carrying out trichloromethane extraction, removing RNA from RNase, and carrying out ethanol precipitation and crude extraction; (3) DNA purification: treating with GDP, purifying with an adsorption column, and eluting with a preheated elution buffer solution; and (4) metagenome sequencing and community analysis are carried out, so that the DNA extraction problem caused by high content of inhibitors such as humic acid and polysaccharide in the soil in the alpine region and special microbial cell wall structures is effectively solved, and the DNA yield, purity and integrity are improved through an optimized splitting decomposition and purification strategy; and technical support is provided for extraction of metagenomes and analysis of microbial community structures in extreme environments such as alpine and the like.