Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of artificial cultivation method of wild leather ear

A technology of wild leather ear and artificial cultivation, applied in cultivation, plant cultivation, mushroom cultivation and other directions, can solve the problem of no report of wild leather ear, and achieve the effects of faster fruiting, better quality and better quality.

Active Publication Date: 2017-09-22
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report about the artificial cultivation method of wild leather ear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of artificial cultivation method of wild leather ear
  • A kind of artificial cultivation method of wild leather ear
  • A kind of artificial cultivation method of wild leather ear

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: use the present invention to carry out the artificial cultivation of wild leather ear

[0035] (1) According to mass percentage, it is 20% of potato, 2% of glucose, 2% of agar, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate and trace vitamin B1, and the rest are made of water. Atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;

[0036] (2) According to the mass percentage, it is composed of 20% of potatoes, 2% of glucose, 2% of agar, 0.5% of peptone, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, trace amount of vitamin B1, and the rest is water to make the isolated parent species Medium slope, 0.11MPa atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;

[0037](3) The raw material composition of the original seed material is 38%-42% of cottonseed hulls, 36%-40% of sawdust, 18%-20% of bran, and 1%-2% of calcium ca...

Embodiment 2

[0049] (1) According to mass percentage, it is 20% of potato, 2% of glucose, 2% of agar, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate and trace vitamin B1, and the rest are made of water. Atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;

[0050] (2) According to the mass percentage, it is composed of 20% of potatoes, 2% of glucose, 2% of agar, 0.5% of peptone, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, trace amount of vitamin B1, and the rest is water to make the isolated parent species Medium slope, 0.11MPa atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;

[0051] (3) The raw material composition of the original seed material is 38%-42% of cottonseed hulls, 36%-40% of sawdust, 18%-20% of bran, and 1%-2% of calcium carbonate by mass percentage. Raw material composition Weigh each component, soak cottonseed hulls in water ov...

Embodiment 3

[0062] Embodiment 3: the identification of wild leather ear

[0063] Large-scale fungal resource collection and investigation were carried out in Dinghushan National Nature Reserve in Zhaoqing, Guangdong, and a fungus of the genus Panus was obtained. On the rotting wood of the forest, its PDA pure culture was obtained by tissue separation, its fruiting body was obtained through the artificial domestication cultivation method of embodiment 1, the fruiting body of domestication was sampled respectively, and its gills and stipe tissue were obtained, and low temperature (40 ℃) drying, using liquid nitrogen to grind, using the Ezup column type fungal genome DNA extraction kit (Sangon Bioengineering (Shanghai) Co., Ltd.) to extract the DNA genome, the obtained DNA solution (DNA template) -20 ℃ Refrigerate and set aside.

[0064] The ITS-PCR experiment was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cultivation method of rare edible fungus, in particular to an artificial cultivation method of panus rudis. The artificial cultivation method comprises the following steps: (1) producing mother seeds; (2) producing pre-culture seeds; (3) producing production seeds; (4) performing inoculation cultivation; (5) performing mushroom production management until fruiting body pileus is changed from an inwards retracted state to a flatly stretching state, and picking. According to the artificial cultivation method, pure strains are obtained by performing tissue isolation and purification on the panus rudis collected from the wild environment; the artificially cultivated fruiting bodies are obtained through artificial domestication and cultivation, so that an important way is provided for the utilization of panus rudis. Compared with the wild state, the fruiting bodies obtained according to the artificial cultivation method are thicker in flesh and have significantly improved individual weight; the panus rudis is faster in mushroom production; the quality of fruiting bodies obtained through artificial domestication are better than that in the wild state.

Description

technical field [0001] The invention relates to a cultivation method of rare edible fungi, in particular to an artificial cultivation method of wild leather ear. Background technique [0002] At present, the edible fungus industry is developing rapidly. The annual output of edible fungi in my country has reached more than 20 million tons, accounting for more than 70% of the world, and the number of employees exceeds 20 million. The fifth place after vegetables, surpassing fruit, tea and sericulture. [0003] Today, with the vigorous development of the edible fungus industry, more and more rare edible fungus varieties have gradually entered people's field of vision, and many original rare varieties have been gradually domesticated, such as bamboo fungus, tea mushroom, and lizhi mushroom; however, there are also A large number of wild edible and medicinal fungi have not been studied because they have not been recognized by humans. Among the 150,000 species of large-scale fung...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01G1/04
CPCA01G18/00C12N1/14
Inventor 胡惠萍刘远超曹仁润黄龙花吴丽霞莫伟鹏
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More