Genital Herpes Vaccine

A vaccinia virus and gene technology, applied in the field of vaccines and immunization, can solve the problems of no specific drugs to control HSV-2 infection and recurrence, and achieve the effect of enhancing vaccine protection, avoiding pre-existing immunity, and improving immune effect.

Active Publication Date: 2018-04-17
CHANGCHUN BCHT BIOTECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] HSV is a typical neurotropic virus, which mainly causes genital inflammation and herpes through sexual contact. The initial infection is mostly recessive infection. It can exist in the human body for a lifetime, and it will cause recurrence when stimulated by external factors. At present, there is no specific drug to control the infection and recurrence of HSV-2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genital Herpes Vaccine
  • Genital Herpes Vaccine
  • Genital Herpes Vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Embodiment 1: the preparation of HSV-2 G virus strain and formaldehyde inactivated vaccine (FI-HSV2)

[0092] 1. Recovery and culture of Vero cells (ATCC code: CCL-81)

[0093] (1) Take out the cryopreservation tube from the liquid nitrogen, place it directly in a constant temperature water bath at 37°C, and shake it from time to time to melt it as soon as possible.

[0094] (2) Take out the cryopreservation tube from the 37°C water bath, suck out the cell suspension, add it to the cytocentrifuge tube and add an appropriate amount of MEM medium (Invitrogen), and mix well.

[0095] (3) Centrifuge at room temperature at 500-800 r / min for 5 minutes.

[0096] (4) Discard the supernatant, add MEM medium containing 10% newborn fetal bovine serum (FBS, Gibco) (volume ratio when the serum is added to the medium, the same below) to resuspend the cells, count, and adjust the cell density to 5×10 5 Cells / mL, inoculate 25cm 2 Disposable cell culture bottle, 37 ℃ incubator sta...

Embodiment 2

[0120] Example 2: Preparation and purification of recombinant adenovirus rAd-gD2ΔUL25 and rAd-gD2

[0121] 1. Construction of pDC316-gD2ΔUL25 and pDC316-gD2 shuttle plasmids

[0122] (1) Use BglII and XhoI (purchased from Takara) to digest PGH-gD2ΔUL25 (design the eukaryotic gD2ΔUL25 gene (SEQ ID NO: 2), and entrust Shanghai Jierui Bioengineering Technology Service Co., Ltd. to synthesize it into PGH vector), 37°C After 2 hours of reaction, the gD2ΔUL25 fragment was recovered with a gel recovery kit (purchased from Takara).

[0123] SEQ ID NO: 2:

[0124] atgaagtacgccctggccgatccctcacttaaaatggcagatcctaaccggttccgaggtaaaaatttgccggtgctggatcagctgaccgatcctccaggcgtcaagagagtgtatcatatccagcccagcctcgaagacccgttccagccaccgtccatcccgatcaccgtttactatgccgtcctggaacgcgcctgtcggtccgtcctgctgcatgctccgtctgaggccccccagatcgtgcgcggtgcatccgacgaagcaagaaaacatacttacaatctgaccatcgcttggtacaggatgggggacaactgtgccattccaatcaccgtgatggagtatacagagtgcccctacaataagagtctgggtgtttgtcctatccggacgcagccacgctggtcttactatgattccttc...

Embodiment 3

[0152] Example 3: Prokaryotic expression and purification of gD protein

[0153] Using the prokaryotic expression method to prepare gD protein for stimulating splenocytes to detect cytokine secretion, the preparation steps are as follows:

[0154] 1. Using the PGH-gD2ΔUL25 described in Example 2 as a template, gDF26 (SEQ ID NO: 13): 5'-ccggaattcatgcatcaccatcaccatcac catcacaagtacgccctggccg-3' and gDR306 (SEQ ID NO: 14): 5'-ccc aagcttctagtcctc cagaagtgcgct -3' is a primer, amplify gD2 by PCR according to the method described in Example 2, recover the product, digest (EcoRI and HindIII, Takara) and connect (T4 ligase, Takara) to the pET-28a expression vector (Novagen), The recombinant expression plasmid pET-28a-gD306 was confirmed by sequencing of Shanghai Sangon Bioengineering Co., Ltd.

[0155] 2. Transform pET-28a-gD306 into Escherichia coli BL21 (Takara), inoculate it in 100ml of LB medium containing kanamycin at 37°C and shake at 250rpm overnight, and transfer it to 1L of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention is a novel genital herpes vaccine, which provides a humanized codon-optimized gene gD2 encoding HSV‑2 glycoprotein D, whose sequence is SEQ ID NO:1. Also provided is a gene gD2ΔUL25 in which the above gD2 gene is fused with a truncated gene encoding HSV‑2 capsid protein UL25, the sequence of which is SEQ ID NO:2. The invention also provides two recombinant adenoviruses, a recombinant modified Ankara strain vaccinia virus and a recombinant varicella-zoster virus respectively comprising the above two genes and their preparation methods. Also provided is the use of the two genes and the recombinant virus in the manufacture of a preparation for preventing and / or treating diseases caused by HSV‑2 (such as genital herpes). The present invention also provides a combined vaccine, which contains different combinations of inactivated HSV‑2 virus and the above-mentioned recombinant virus.

Description

technical field [0001] The invention relates to the field of vaccines and immunity, in particular to a genital herpes vaccine. Background technique [0002] Globally, genital herpes (Genital Herpes, GH) has become one of the most widespread sexually transmitted diseases (STDs). Genital herpes mainly occurs in the genital area, and pustules form erosions or ulcers, and lead to a series of complications, such as: herpetic meningitis, myelopathy, pelvic inflammatory disease, etc. The incidence of genital herpes is high, and it can also infect newborns through the placenta and birth canal, leading to severe neonatal sequelae and even death, and it is related to the occurrence of cervical cancer. In addition, studies have shown that GH can increase HIV (human immunodeficiency virus) infection rate, and can accelerate the development of the disease, causing serious local and disseminated infections, therefore, genital herpes has become a public health problem that seriously endan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/38C12N15/62C12N7/01C12N15/861A61K39/245A61P31/22
Inventor姜春来孔维刘微
OwnerCHANGCHUN BCHT BIOTECH