Kit for distinguishing and detecting bovine piroplasmosis and preparation and usage method
The technology of a bovis and a detection method is applied in the field of identification and detection of animal parasites, can solve the problems of non-inclusion, unpopular operation procedures, instruments and equipment, high cost, etc., and saves time, manpower and material resources, and saves time. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0015] 1. Establishment of PCR-RFLP detection method for Pyricularia bovis:
[0016] The specific operating procedures are as follows:
[0017] 1. Design and synthesis of universal primers for Piriformis
[0018] A pair of pyriformis universal primers designed in the conserved regions at both ends of the Pyricularis RPS8 gene sequence can amplify the target gene with a size of 707bp~855bp. The universal primers are artificially synthesized by Shenggong Bioengineering (Shanghai) Co., Ltd. according to design requirements. The specific sequence of the universal primer is as follows:
[0019] Upstream primer RPS8-F: (5’- ATGGGTATTTCACGTGACAG -3’);
[0020] Downstream primer RPS8-R: (5'-GCGTTTCTTCTTATCCATACG -3').
[0021] 2. PCR-RFLP detection method for the detection of Pyricularia bovis (a detection method for non-disease diagnosis)
[0022] Preliminary experiments have determined that the best amount of universal primer in the buffer is 10 pmol / μl and the best PCR conditions are: 94℃ / 3m...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 