Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for distinguishing and detecting bovine piroplasmosis and preparation and usage method

The technology of a bovis and a detection method is applied in the field of identification and detection of animal parasites, can solve the problems of non-inclusion, unpopular operation procedures, instruments and equipment, high cost, etc., and saves time, manpower and material resources, and saves time. Effect

Inactive Publication Date: 2015-08-05
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The technical effect of this patented technology described in the patents involves identifying different forms of Bacterial Spiratory Synthesis Pathway (BSSP), specifically those involved in tick bites and tape worms, through various techniques such as polymerase chain reaction (PCR). By comparing these results from multiple sources, we found out how differences between them were related to their ability to cause diseases like Borreliae spp., Tylosoma spirochetes, etc.). These findings could help researchers better identify areas where they may have been exposed without being affected due to previous exposure.

Problems solved by technology

The technical problem addressed in this patented text relates how to improve upon existing methods for analyzing data by improving their accuracy or efficiency when processing large amounts of data quickly without sacrificing speed-up capabilities.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for distinguishing and detecting bovine piroplasmosis and preparation and usage method
  • Kit for distinguishing and detecting bovine piroplasmosis and preparation and usage method
  • Kit for distinguishing and detecting bovine piroplasmosis and preparation and usage method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0015] 1. Establishment of PCR-RFLP detection method for Pyricularia bovis:

[0016] The specific operating procedures are as follows:

[0017] 1. Design and synthesis of universal primers for Piriformis

[0018] A pair of pyriformis universal primers designed in the conserved regions at both ends of the Pyricularis RPS8 gene sequence can amplify the target gene with a size of 707bp~855bp. The universal primers are artificially synthesized by Shenggong Bioengineering (Shanghai) Co., Ltd. according to design requirements. The specific sequence of the universal primer is as follows:

[0019] Upstream primer RPS8-F: (5’- ATGGGTATTTCACGTGACAG -3’);

[0020] Downstream primer RPS8-R: (5'-GCGTTTCTTCTTATCCATACG -3').

[0021] 2. PCR-RFLP detection method for the detection of Pyricularia bovis (a detection method for non-disease diagnosis)

[0022] Preliminary experiments have determined that the best amount of universal primer in the buffer is 10 pmol / μl and the best PCR conditions are: 94℃ / 3m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for differential diagnosis on bovine piroplasmosis infection situation of bovine animals and a preparation and usage method thereof. The kit for distinguishing and detecting bovine piroplasmosis comprises an SEQ ID No.1 primer, an SEQ ID No.2 primer and Mbo I enzyme. The situation of bovine infection of theileria and babesia can be preliminarily judged, the mixed infection situation of the theileria and babesia can be further detected, the specific species, mixed infection and other situations of infected piroplasma can be directly judged after further enzymatic detection, and a detection method is relatively simple, the time consumed by detection process is short, and the cost is low.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com