Supercharge Your Innovation With Domain-Expert AI Agents!

PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method

A technology for human immunodeficiency and detection kits, applied in biochemical equipment and methods, microorganism-based methods, microorganisms, etc. Specific, clinically applicable effects

Active Publication Date: 2015-08-19
GUANGZHOU SUPBIO BIO TECH & SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method requires high personnel and equipment, is expensive, requires a large amount of samples (120-180mL blood), is time-consuming and laborious, and there are many factors that affect the accuracy of the results, the detection rate is low, and it is not suitable for tissue biopsy
② The count of CD4+ T lymphocytes is mostly detected by CD4 / 8 / 3 flow cytometry, but there is no evidence that it can directly reflect the changes of the HIV virus reservoir, and whether there is a certain correlation needs to be further verified
[0010] In summary, the traditional HIV testing methods are limited by the "window period", time-consuming, costly, high requirements for specimens, and low detection sensitivity. Need to develop a highly sensitive HIV DNA detection method
At present, there are few HIV DNA detection kits at home and abroad, and the sensitivity of the HIV DNA PCR detection method reported in the article is 10 copies or more of HIV DNA per million cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method
  • PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method
  • PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: PCR primer set for detection of human immunodeficiency virus type 1 DNA

[0061] In the early stage of the present invention, a large number of PCR primers for detecting human immunodeficiency virus type 1 DNA were designed based on the principle of primer design and combined with the actual situation, and then high-sensitivity and high-specificity primer sequences and detection probes were screened out through a large number of experimental studies, and finally selected The PCR primer sets with the best effect for detecting human immunodeficiency virus type 1 DNA include 3 sets, and their nucleotide sequences are as follows:

[0062] Primer set 1:

[0063] SEQ ID NO: 1: TCTGGCTAACTAGGGAACCCACTGCT;

[0064] SEQ ID NO: 2: TGCGCGCTTCAAGCCGAGTCCTGCGT;

[0065] SEQ ID NO: 3: AGGGAACCCACTGCTTAAGCCTCAATAAAGCT;

[0066] SEQ ID NO: 4: AGCAAGCCGAGTCCTGCGTCGAGA;

[0067] SEQ ID NO: 5: AGCCTCAATAAAGCTTGCCT;

[0068] SEQ ID NO: 6: CCGCCACTGCTAGAGATTTTCCA;

[0069...

Embodiment 2

[0095] Example 2: PCR detection kit for detection of human immunodeficiency virus type 1

[0096] The PCR test kit for detection of human immunodeficiency virus type 1 includes the following components:

[0097] 1) containing at least one set of primers described in Example 1;

[0098] 2) Contains detection probes:

[0099] When the kit contains primer set 1, the kit also contains probe SEQ ID NO: 15 or its nucleotide complement;

[0100] When the kit contains primer set 2, the kit also contains at least one of the probes SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or the nucleotide complementary sequences of these sequences probe;

[0101] When primer set 3 is contained in the kit, the kit also contains probes SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22 or nucleotides of these sequences at least one probe in the complementary sequence.

[0102] The fluorescent group labeled at the 5' end of the probe sequence is any one of FAM, HEX, VIC, CY5, and TET...

Embodiment 3

[0114] Example 3: Detection method of human immunodeficiency virus type 1 PCR detection kit

[0115] Utilize the detection kit established in Example 2 to detect the sample to be detected, and the steps are as follows:

[0116] 1) DNA extraction:

[0117] Take 200 μl of the whole blood sample to be tested, negative quality control material, weak positive quality control material, strong positive quality control material, and positive quantitative reference material, use the QIAamp DNA Blood Mini Kit extraction kit, and follow the whole blood sample extraction steps in the instruction manual. , the elution volume is 100uL, and the DNA in each group of samples is extracted and used as the subsequent PCR template;

[0118] 2) PCR reaction system:

[0119] PCR reaction solution 29.2μL;

[0120] Enzyme system 0.8μL;

[0121] DNA template 20μL;

[0122] 3) PCR reaction program:

[0123] Taking ABI7500 as an example, the first step: 37°C for 5 minutes; the second step: 95°C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses PCR primer groups and a probe used for detecting human immunodeficiency virus type I, a kit containing the PCR primer groups and the probe, and a detection method. The kit contains the high sensitivity primer groups and the probe. According to the detection method, multiple circulation is designed, and temperature is increased to a primer annealing temperature, and extremely high sensitivity and specificity are achieved. According to the minimum detection limit, in each time of detection, 2 copies HIV-1 DNA / millions of cells can be realized, and sensitivity of the detection method is higher than that of other detection methods. A cell quantitative system is introduced into the detection method, so that quantification of HIV-1 DNA and cell number can be realized simultaneously in a same reaction. A quantitative standard substance is added into the kit so as to solve a problem of HIV DNA auantitative traceability in the prior art, wherein the quantitative standard substance is simple to prepare, is stable, and is reliable in traceability. The PCR primer groups, the probe, the kit, and the detection method can be used for HIV infection early detection, HIV infection screening of infants or high risk groups, HIV-1 virus repository detection, antiviral drug therapeutic effect evaluation, disease relapse control, and radical cure standard establishment; operation is simple; cost is low; clinical application prospect is promising; and it is beneficial for popularization and application.

Description

technical field [0001] The invention belongs to the field of virus detection, and relates to a PCR primer set, a probe, a kit thereof and a detection method for detecting human immunodeficiency virus type 1. Background technique [0002] AIDS is acquired immunodeficiency syndrome (acquired immunodeficiency syndrome, AIDS), is a chronic fatal infectious disease, caused by human immunodeficiency virus (human immunodeficiency virus, HIV), divided into human immunodeficiency virus type 1 (HIV- 1) and human immunodeficiency virus type 2 (HIV-2), HIV-1 is currently the main strain circulating in the world including China, and HIV-2 is currently only circulating in West Africa. After HIV infection, the immune function of the human body is deficient, and a series of clinical syndromes such as opportunistic infections and tumors occur, and the fatality rate is almost 100%. According to 2011 data, AIDS has spread to more than 200 countries and regions around the world, the total numb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/686C12Q1/703C12Q2527/101C12Q2545/101C12Q2545/113
Inventor 朱托夫
Owner GUANGZHOU SUPBIO BIO TECH & SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More