Method for identifying material sources of meat products based on clone and conventional sequencing

A meat product and sequencing technology, applied in the field of molecular biology, can solve the problems of inaccurate and difficult identification results, and achieve the effect of ensuring accuracy and high accuracy

Inactive Publication Date: 2015-10-14
SHANGHAI PASSION BIOTECHNOLOGY CO LTD
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional morphological identification methods are only applicable to meat samples in complete form. Once processed, such as fish fillets, minced meat, etc., those c

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying material sources of meat products based on clone and conventional sequencing
  • Method for identifying material sources of meat products based on clone and conventional sequencing
  • Method for identifying material sources of meat products based on clone and conventional sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Material source identification of embodiment 1 canned meat product

[0020] 1. Take the canned meat products, and carry out DNA extraction on the meat products in the cans. The DNA extraction kit of Axygen Biotechnology Co., Ltd. of the United States is used for extraction. The extraction steps are as follows:

[0021] 1) Take 20 mg of meat products, transfer them into a mortar pre-cooled in an ice-water bath, and quickly and vigorously grind them into a homogenate.

[0022] 2) After adding 350 μl Buffer PBS and 0.9 μl RNase A, grind gently for 30 seconds.

[0023] 3) Collect 350 μl of ground tissue homogenate and transfer to a 2 ml centrifuge tube. If the homogenate volume is less than 350 μl, add PBS to 350 μl.

[0024] 4) Add 150 μl Buffer C-L and 20 μl proteinase K. Immediately vortex for 1 min to mix well. After brief centrifugation, place the centrifuge tube in a 56°C water bath for 10 min. (Do not add Proteinase K directly to Buffer C-L).

[0025] 5) Add 35...

Embodiment 2~4

[0052] Examples 2-4 are verified with the identification of known fresh animal tissues, high-pressure processed meat products, and jerky

[0053] Get the fresh animal tissue of known source, high-pressure processed meat product and meat jerky respectively as the meat product sample to be tested, carry out experiment according to the same method steps in Example 1 respectively, verify the accuracy of the method in Example 1 (step are the same, so they will not be repeated), and the COI sequence information of the three meat product samples are respectively obtained as follows:

[0054] Fresh animal tissue:

[0055] The COI sequence (SEQ ID NO:4) is as follows

[0056] AACTGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTGCACGGCGGTGCCATTAAATGAGAAACCCCTCTCCTGTGGGCGCTAGGCTTCATTTTCCTCTTTACAGTTGGAGGATTGACCGGAATCGTTCTAGCTAATTCTTCTCTAGACATTATGCTTCACGACACATATTATGTCGTCGCCCACTTCCACTATGTCCTCTCAATAGGAGCCGTTTTCGCCATTGTTGCCGGCTTCGTCCACTGATTCCCCCTATTCTCAGGGTACACGCTTCACGACACTTGAACAAAAATCCACTTTGGGGTTATATTTGTAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology and discloses a method for identifying material sources of meat products based on clone and conventional sequencing. The method comprises the following steps: (1) extracting to-be-detected genome DNA; (2) designing and synthesizing a forward primer and a backward primer; (3) carrying out PCR amplification on the genome DNA, and detecting and recycling amplification products; (4) carrying out TA cloning on the PCR amplification products to obtain positive clones, selecting single clones, and carrying out sequencing; and (5) removing carrier sequences at two ends in a sequencing result to obtain COI sequence information of to-be-detected meat products, and therefore, identifying the material sources of the meat products. By virtue of the method, the material compositions and sources of the meat products can be identified, and species can be well differentiated by virtue of difference among base sequences in the COI gene sequence, so that the method for identifying the material sources of the meat products has relatively high accuracy.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for identifying the source of meat product materials based on cloning and conventional sequencing. Background technique [0002] With the development of the economy and the improvement of people's living standards, the consumption of meat and meat products has developed extremely rapidly. Due to the huge difference in the value of different types of meat, there are more and more phenomena of mislabeling and shoddy products. Determining the meat used in the product and verifying product label information can play a role in protecting consumer rights, combating counterfeiting and mislabeling, and ensuring the quality of imported and exported products. To determine the meat used in the product, there must be a reliable and accurate method for identifying the meat species. [0003] The identification of meat species mainly includes morphological methods and molecu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6869C12Q2531/113C12Q2535/101
Inventor孙子奎高文学丁方美王峰方婉
OwnerSHANGHAI PASSION BIOTECHNOLOGY CO LTD