A key marker site affecting the content of c20:0 saturated fatty acid in pig muscle and its application

A site and marker technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as the inability to determine the key variation sites of the main gene, and the breeding and improvement of difficult breeding pigs, etc. Achieve the effect of optimizing fatty acid composition, high quality and improving nutritional level

Active Publication Date: 2018-05-08
JIANGXI AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is still impossible to determine the real main effect gene and its key variation sites in this interval, and it is still difficult to directly apply it to the breeding and improvement of breeding pigs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A key marker site affecting the content of c20:0 saturated fatty acid in pig muscle and its application
  • A key marker site affecting the content of c20:0 saturated fatty acid in pig muscle and its application
  • A key marker site affecting the content of c20:0 saturated fatty acid in pig muscle and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Detection of 60,000 (60K) SNP genotypes in the whole pig genome: from the above F 2 A small piece of ear tissue sample was collected from each individual in the resource group and Sutai pig group, and the whole genome DNA was extracted by the standard phenol-chloroform method. After the quality was tested by the Nanodrop-100 spectrophotometer, the concentration was uniformly diluted to 50ng / ul. On the Illumina Beadstation platform, the pig whole genome 60K SNP (Illumina, USA) genotype was determined according to the company's standard process. Use PLINK (1.07) to perform quality control on the 60K chip data of all samples, and eliminate individuals whose detection rate is lower than 95%, and whose family Mendelian error rate is higher than 0.1; and the detection rate is lower than 95%, and the minimum allele frequency is less than 0.05 and Hardy-Weinberg equilibrium significance above 10 -6 SNP markers.

[0045] Genome-wide association (GWAS) analysis, fine mapping an...

Embodiment 2

[0049] This example is the application of the SNP sites g.42561841G>A and / or g.42564441C>T obtained in Example 1 in breeding pigs. SNP locus g.42561841G>A typing: Using the genomic DNA of F2, Sutai population, Laiwu population, Erhualian population and Du Dachang business population as templates, ABI 7900 real-time fluorescent quantitative PCR system was used for genotyping. The reaction system is as follows: DNA template 1 μl, front primer (GGATGAATGGCATAGATAAAAAGATG) 0.2 μl, back primer (GGTAGATCGCAATCCTTCAGTTTC) 0.2 μl, SEQ ID NO: 2 0.15 μl, SEQ ID NO: 30.15 μl, TaqProbe Mix 5 μl, add ddH2O to make up to 10 μl; The conditions are as follows: pre-denaturation at 50°C for 2min; denaturation at 94°C for 10min, 95°C for 15s, 60°C for 15s, 40 cycles. Only VIC fluorescence indicates that the allele type is homozygous GG; only FAM fluorescence indicates that the allele type is homozygous AA; both VIC and FAM fluorescence indicate that the allele type is heterozygote GA.

[0050] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a SNP marker affecting pork fatty acid components, characterized in that the SNP marker is located on the nucleotide sequence of the ultra-long-chain fatty acid elongase 7 gene on pig chromosome 16, and the SNP marker is SEQ A mutation from G to A at the 8462nd position on ID NO:1, or a C to T mutation at the 11062nd position on SEQ ID NO:1. The present invention also relates to a probe for identifying the SNP marker and its application. The present invention further relates to a pig breeding method and a detection method for the pig breeding.

Description

[0001] Cross-References to Associated Applications [0002] This application claims the priority of the Chinese patent application with application number 201510531321.9 (the invention title of which is "A SNP Marker and Its Application") submitted on August 26, 2015. The entire content of this application is incorporated herein by reference. technical field [0003] The present invention relates to a biological marker, in particular to a SNP marker. The present invention also relates to a probe for identifying the SNP marker and its application. The present invention further relates to a pig breeding method and a detection method for the pig breeding. Background technique [0004] Fatty acids (FA) are the basic components of cells and play an important role in energy storage, information transmission and metabolic regulation in the body. However, high levels of saturated fatty acids are very harmful to the health of the body. Such as arachidic acid (arachidic acid), wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor张志燕黄路生章峰任军何玉娜杨斌
OwnerJIANGXI AGRICULTURAL UNIVERSITY