SNP marker and application thereof

A technology for marking and breeding pigs, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of difficult breeding and improvement of breeding pigs, and the inability to determine the key mutation sites of the main effect genes, etc., to achieve the optimization of fatty acids Composition, high quality, effect of increasing nutritional level

Active Publication Date: 2015-12-30
JIANGXI AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is still impossible to determine the real main effect gene and its key variation sites in this interval, and it is still difficult to directly apply it to the breeding and improvement of breeding pigs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP marker and application thereof
  • SNP marker and application thereof
  • SNP marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Detection of 60,000 (60K) SNP genotypes in the whole pig genome: from the above F 2 A small piece of ear tissue sample was collected from each individual in the resource group and Sutai pig group, and the whole genome DNA was extracted by the standard phenol-chloroform method. After the quality was tested by the Nanodrop-100 spectrophotometer, the concentration was uniformly diluted to 50ng / ul. The pig whole genome 60KSNP (Illumina, USA) genotype determination was performed on the Illumina Beadstation platform according to the company's standard procedures. Use PLINK (1.07) to perform quality control on the 60K chip data of all samples, and eliminate individuals whose detection rate is lower than 95%, and whose family Mendelian error rate is higher than 0.1; and the detection rate is lower than 95%, and the minimum allele frequency is less than 0.05 and Hardy-Weinberg equilibrium significance above 10 -6 SNP markers.

[0045] Genome-wide association (GWAS) analysis, f...

Embodiment 2

[0049] This example is the application of the SNP sites g.42561841G>A and / or g.42564441C>T obtained in Example 1 in breeding pigs. SNP site g.42561841G>A typing: Using the genomic DNA of F2, Sutai population, Laiwu population, Erhualian population and Duda business population as templates, the ABI7900 real-time fluorescent quantitative PCR system was used for genotyping, and the reaction The system is as follows: DNA template 1 μl, front primer (GGATGAATGGCATAGATAAAAAGATG) 0.2 μl, back primer (GGTAGATCGCAATCCTTCAGTTTC) 0.2 μl, SEQ ID NO: 20.15 μl, SEQ ID NO: 30.15 μl, TaqProbeMix 5 μl, add ddH2O to make up to 10 μl; reaction conditions are as follows: pre-denaturation at 50°C for 2 minutes ; Denaturation at 94°C for 10min, 95°C for 15s, 60°C for 15s, 40 cycles. Only VIC fluorescence indicates that the allele type is homozygous GG; only FAM fluorescence indicates that the allele type is homozygous AA; both VIC and FAM fluorescence indicate that the allele type is heterozygote G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an SNP marker influencing fatty acid components of pork. The SNP marker is characterized by being located on a nucleotide sequence of a super-long chain fatty acid elongase gene 7 on the 16th chromosome of a pig and being formed by mutating G to A on the 8462th site on SEQ ID NO:1 or mutating C to T on the 11062nd site on SEQ ID NO:1. The invention further relates to a probe for authenticating the SNP marker and application of the SNP marker. The invention further relates to a pig breeding method and a pig breeding detecting method.

Description

[0001] Cross-References to Associated Applications [0002] This application claims the priority of the Chinese patent application with application number 201510531321.9 (the invention title of which is "A SNP Marker and Its Application") submitted on August 26, 2015. The entire content of this application is incorporated herein by reference. technical field [0003] The present invention relates to a biological marker, in particular to a SNP marker. The present invention also relates to a probe for identifying the SNP marker and its application. The present invention further relates to a pig breeding method and a detection method for the pig breeding. Background technique [0004] Fatty acids (FA) are the basic components of cells and play an important role in energy storage, information transmission and metabolic regulation in the body. However, high levels of saturated fatty acids are very harmful to the health of the body. For example, arachidic acid (arachidic acid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor张志燕黄路生章峰任军何玉娜杨斌
OwnerJIANGXI AGRICULTURAL UNIVERSITY