SNP molecular markers related to chicken-fertilization duration time characters and application thereof
A technology of duration and molecular markers, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., which can solve the problems of troublesome measurement and large economic investment.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0036] The invention provides a SNP molecular marker related to chicken fertilization duration traits, the chicken fertilization duration traits related SNP molecular marker is chicken fertilization duration in the first intron of chicken TGFB3 (transforming growth factor-β3) gene Trait-associated SNP molecular markers.
[0037] The nucleotide sequence of the SNP molecular marker related to chicken fertilization duration traits provided by the present invention is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4;
[0038] When the SNP molecular marker associated with chicken fertilization duration traits is SEQ ID NO: 1, the nucleotide sequence of SEQ ID NO: 1 is:
[0039] TCCTCTGCCTCAGGCCAGAACAGCTTGGCTCCCTAGTGCCGGCCCCAGCRTTCGGTGCAAGGCCACAGGTGAGAGGGAGGAGATCCCATACTTTGCTCCA;
[0040] The 50th base R in the sequence of SEQ ID NO: 1 is C or T, resulting in polymorphism;
[0041] When the SNP molecular marker associated with chicken fertilization duration traits is SEQ ID...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


