Functional molecular marker for corn germination potential gene ZmGLP and application of functional molecular marker
A technology of functional molecules and germination potential, applied in the field of genetic engineering, can solve problems such as differences in germination rate and achieve the effect of improving efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1: Development of functional molecular markers of corn seed germination potential gene ZmGLP
[0052] (1) Sequence structure analysis of maize ZmGLP gene
[0053] The inventors analyzed and studied the differentially expressed proteins in the germination process of Nongda 108, Zhengdan 958, Xianyu 335, Yuyu 22, Jundan 20 and Jundan 18 and their corresponding parental seeds. On the above, the gi|195606798 protein that affects the germination characteristics of seeds was obtained, the reference sequence of the ZmGLP gene was extracted, and multiple pairs of amplification and sequencing primers were designed to amplify the ZmGLP gene of 40 maize inbred lines. Two pairs of primers including UTR, exon, intron and 3'UTR (cupinF2: CGTAGCACCAGAAAAGAAATGTA / cupinR1: CACAGGTAGGCGGTAGCAGC, cupinF6: GGGGAAGCGAAGGTTGGGTAT / cupinR7: ACAAACGGTCACTGCGGGAC) were used to amplify and sequence the ZmGLP gene sequences of other inbred lines .
[0054] The promoter region of the gene...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap