RNA inhibitor and application thereof in tumors
An inhibitor and tumor technology, applied in the field of biomedicine, can solve problems such as cardiotoxicity and drug resistance of targeted drugs, and achieve the effect of promoting tumor cell apoptosis, preventing and treating tumors.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1, the application of inhibitors of miR-17-5p in inhibiting the growth of breast cancer
[0035] 1. Obtaining inhibitors of miR-17-5p
[0036] The artificially synthesized miR-17-5p inhibitor has cholesterol modification and methylation modification. The miR-17-5p inhibitor (including sequence synthesis and cholesterol modification and methylation modification) is produced by Guangzhou Ruibo Biotechnology Co., Ltd. Finish.
[0037] The nucleotide sequence of the miR-17-5p inhibitor is SEQ ID NO.1 in the sequence listing, namely cuaccugcacuguaaagcacuuug.
[0038] The negative control RNA (with cholesterol modification and methylation modification) of miR-17-5p inhibitor was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., it is miRNA mimic Ncontrol#22, and the product information is:
[0039] Basic information: common miRNA mimic Ncontrol#22 for humans, mice, and rats.
[0040] Mature miRNA name: cel-miR-239b-5p;
[0041] Mature miRNA number: MIMAT0000...
Embodiment 2
[0072] Example 2, the effect of inhibitors of miR-17-5p on the proliferation of breast cancer cells MDA-MB-231
[0073] The control in Example 2 is the negative control RNA of the miR-17-5p inhibitor.
[0074] 1. miR-17-5p inhibitor inhibits the proliferation of breast cancer cell MDA-MB-231
[0075] The inhibitory effect of miR-17-5p inhibitor on the proliferation of breast cancer cell MDA-MB-231 was detected by CCK-8 kit (purchased from Dojin Chemical Research Institute, Japan, Cat. No. CK04-05). The specific operation steps are as follows:
[0076] 1. Spread MDA-MB-231 cells into a 12-well plate and store at 37°C CO 2 Cultivate in the incubator for 16-24 hours, so that the cell confluence is about 60%, add 50pm miR-17-5p inhibitor as the experimental group and 50pm control (ie, the negative control of miR-17-5p inhibitor) respectively. for the control group. After 48 hours of growth, the cells were plated into 96-well plates with a confluence of about 50%. Three replic...
Embodiment 3
[0104] Example 3, the effect of miR-17-5p on the proliferation of breast cancer cell MCF-7
[0105] 1. Acquisition of miR-17-5p
[0106] Artificially synthesized miR-17-5p, with cholesterol modification and methylation modification, miR-17-5p (including sequence synthesis, cholesterol modification and methylation modification) was synthesized in Guangzhou Ruibo Biotechnology Co., Ltd.
[0107] The nucleotide sequence of miR-17-5p is SEQ ID NO.2 in the sequence listing, namely caaagugcuuacagugcagguag.
[0108] The negative control RNA of miR-17-5p (with cholesterol modification and methylation modification) was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., miRNA mimic Ncontrol#22, and the product information is as follows:
[0109] Basic information: common miRNA mimic Ncontrol#22 for humans, mice, and rats;
[0110] Mature miRNA name: cel-miR-239b-5p;
[0111] Mature miRNA number: MIMAT0000295;
[0112] Mature miRNA sequence: UUUGUACUACACAAAAGUACUG).
[0113] Th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More