Haliotis discus hannai superoxide dismutase, and preparation method and application thereof
A technology of superoxide and wrinkled abalone, which is applied in botany equipment and methods, biochemical equipment and methods, redox enzymes, etc., can solve the problems of difficulty in maintaining natural structure, complicated direct separation and extraction process, and high cost of chemical synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0055] The present invention provides a method for preparing superoxide dismutase of abalone wrinkled by means of genetic engineering, specifically by constructing a gene encoding superoxide dismutase of abalone wrinkled into the carrier by means of a Pichia pastoris expression vector, Then, the method is introduced into host cells, and the engineered bacteria strains capable of expressing the superoxide dismutase of the abalone rugosa are screened, then fermented and cultured, induced to express, and purified to obtain the protein. Wherein, in a preferred embodiment of the present invention, the preparation method of the superoxide dismutase of abalone rugosa comprises the following steps:
[0056] (1): Construct the expression vector of Pichia pastoris for Hdh Cu / Zn SOD of abalone rugosa;
[0057] (2): introducing the Pichia pastoris expression vector obtained in step (1) into a host cell, and inducing expression of the host cell to obtain a genetically engineered bacterial ...
Embodiment 1
[0062] Embodiment 1 The construction of the recombinant expression vector of Hdh Cu / Zn SOD of wrinkled disc abalone
[0063] 1) Acquisition of Hdh Cu / Zn SOD gene from Abalone rugosa
[0064] According to the multiple cloning site of the pPIC9K vector, the specific upstream primer F1 and downstream primer R1 were designed to amplify the Hdh Cu / Zn SOD gene encoding the Abalone rugosa. PCR amplification of the Hdh Cu / Zn SOD gene sequence of the wrinkled plate abalone:
[0065] Add an Eco I restriction site to the 5' end of the upstream primer Hdh Cu / Zn SOD-S, add a Not I restriction site to the 5' end of the downstream primer Hdh Cu / ZnSOD-A, a stop codon and 6× His histidine tag: the downstream primer uses the Not I restriction site:
[0066] The sequence of the upstream primer Hdh Cu / Zn SOD-S is shown in SEQ ID NO.3: 5`GGGGAATTCTCTATCAAAGCAGTTTGTG 3`, wherein the fourth to ninth bases in the sequence of SEQ ID NO.3 represent the introduced Eco I Restriction sites.
[0067] T...
Embodiment 2
[0088] Example 2 Induced expression of pPIC9K-Hdh Cu / Zn SOD recombinant plasmid in Pichia pastoris GS115
[0089] 1) Linearization of pPIC9K-Hdh Cu / Zn SOD
[0090] The correctly sequenced strain containing the expression vector was streaked and cultured, and the single clone was picked and shaken for culture. After the plasmid was extracted, 10 μg of the plasmid was linearized by Sac Ⅰ restriction endonuclease. The reaction system was as follows:
[0091] Table 5 Recombinant plasmid linearization reaction system
[0092]
[0093]
[0094] The linearized pPIC9K-Hdh Cu / Zn SOD was recovered by nucleic acid co-precipitation agent. Then it was transformed into Pichia pastoris GS115 competent cells by electric shock method, and its expression was induced.
[0095] 2) Optimization of expression conditions of pPIC9K-Hdh Cu / Zn SOD
[0096] Pichia pastoris GS115 transformed with the pPIC9K-Hdh Cu / Zn SOD recombinant plasmid was used as the experimental group, and the monoclonal ...
PUM
Property | Measurement | Unit |
---|---|---|
Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com