Check patentability & draft patents in minutes with Patsnap Eureka AI!

Haliotis discus hannai superoxide dismutase, and preparation method and application thereof

A technology of superoxide and wrinkled abalone, which is applied in botany equipment and methods, biochemical equipment and methods, redox enzymes, etc., can solve the problems of difficulty in maintaining natural structure, complicated direct separation and extraction process, and high cost of chemical synthesis

Inactive Publication Date: 2017-07-21
FISHERIES RES INST OF FUJIAN
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented method allows for efficient production of proteins with powerful anti-radiation properties such as enzymes called Cuprous oxidenanone peroxygenase (COPD) or catalases like laccase B from bacterial cells. These molecules can remove harmful substances during processing and storage processes without affecting their quality.

Problems solved by technology

This patented technical problem addressed in this patents relates to finding ways to efficiently separate or isolate useful components found naturally within seafood products like abalone without causing damage during processing steps that could affect beneficial properties.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haliotis discus hannai superoxide dismutase, and preparation method and application thereof
  • Haliotis discus hannai superoxide dismutase, and preparation method and application thereof
  • Haliotis discus hannai superoxide dismutase, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0055] The present invention provides a method for preparing superoxide dismutase of abalone wrinkled by means of genetic engineering, specifically by constructing a gene encoding superoxide dismutase of abalone wrinkled into the carrier by means of a Pichia pastoris expression vector, Then, the method is introduced into host cells, and the engineered bacteria strains capable of expressing the superoxide dismutase of the abalone rugosa are screened, then fermented and cultured, induced to express, and purified to obtain the protein. Wherein, in a preferred embodiment of the present invention, the preparation method of the superoxide dismutase of abalone rugosa comprises the following steps:

[0056] (1): Construct the expression vector of Pichia pastoris for Hdh Cu / Zn SOD of abalone rugosa;

[0057] (2): introducing the Pichia pastoris expression vector obtained in step (1) into a host cell, and inducing expression of the host cell to obtain a genetically engineered bacterial ...

Embodiment 1

[0062] Embodiment 1 The construction of the recombinant expression vector of Hdh Cu / Zn SOD of wrinkled disc abalone

[0063] 1) Acquisition of Hdh Cu / Zn SOD gene from Abalone rugosa

[0064] According to the multiple cloning site of the pPIC9K vector, the specific upstream primer F1 and downstream primer R1 were designed to amplify the Hdh Cu / Zn SOD gene encoding the Abalone rugosa. PCR amplification of the Hdh Cu / Zn SOD gene sequence of the wrinkled plate abalone:

[0065] Add an Eco I restriction site to the 5' end of the upstream primer Hdh Cu / Zn SOD-S, add a Not I restriction site to the 5' end of the downstream primer Hdh Cu / ZnSOD-A, a stop codon and 6× His histidine tag: the downstream primer uses the Not I restriction site:

[0066] The sequence of the upstream primer Hdh Cu / Zn SOD-S is shown in SEQ ID NO.3: 5`GGGGAATTCTCTATCAAAGCAGTTTGTG 3`, wherein the fourth to ninth bases in the sequence of SEQ ID NO.3 represent the introduced Eco I Restriction sites.

[0067] T...

Embodiment 2

[0088] Example 2 Induced expression of pPIC9K-Hdh Cu / Zn SOD recombinant plasmid in Pichia pastoris GS115

[0089] 1) Linearization of pPIC9K-Hdh Cu / Zn SOD

[0090] The correctly sequenced strain containing the expression vector was streaked and cultured, and the single clone was picked and shaken for culture. After the plasmid was extracted, 10 μg of the plasmid was linearized by Sac Ⅰ restriction endonuclease. The reaction system was as follows:

[0091] Table 5 Recombinant plasmid linearization reaction system

[0092]

[0093]

[0094] The linearized pPIC9K-Hdh Cu / Zn SOD was recovered by nucleic acid co-precipitation agent. Then it was transformed into Pichia pastoris GS115 competent cells by electric shock method, and its expression was induced.

[0095] 2) Optimization of expression conditions of pPIC9K-Hdh Cu / Zn SOD

[0096] Pichia pastoris GS115 transformed with the pPIC9K-Hdh Cu / Zn SOD recombinant plasmid was used as the experimental group, and the monoclonal ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to a haliotis discus hannai superoxide dismutase, and a preparation method and application thereof. The invention discloses a haliotis discus hannai superoxide dismutase gene which contains a base sequence described in SEQ ID No.1 or a gene with a code shown by protein (a) or (b) as follows: (a) protein consisting of an amino acid sequence shown in SEQ ID No.1; and (b) protein derived by (a), which is formed by replacing, losing or adding one or a plurality of amino acids in the amino acid sequence restricted by (a) and has superoxide dismutase activity. Meanwhile, the invention discloses protein encoded by the gene and a recombinant vector as well as the preparation method of the superoxide dismutase. By the preparation method, the superoxide dismutase is obtained with the help of genetic engineering technology, and the protein has very strong activities in removal of superoxide anion free radicals and hydroxyl radicals, safety, damage repair and the like, and can give play to application value in the fields such as food additives, drug preparation, cosmetics and the like.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner FISHERIES RES INST OF FUJIAN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More