Cotton fiber length-related quantitative trait locus (QTL) and application thereof

A cotton fiber, BNL1667R technology, applied in the field of plant genetics, can solve the problems of low QTL accuracy and stability

Active Publication Date: 2017-09-26
NANTONG UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current low-density genetic map and temporary isolates make the accuracy and stability of the detected QTLs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton fiber length-related quantitative trait locus (QTL) and application thereof
  • Cotton fiber length-related quantitative trait locus (QTL) and application thereof
  • Cotton fiber length-related quantitative trait locus (QTL) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Upland cotton PD94042 (P 1 ) as the recipient parent, G.mustelinum (P 2 ) as the donor parent, and upland cotton PD94042 (P 1 ) were recurrent parents backcrossed for three generations, and then self-crossed for three generations to construct a backcrossed high-generation population, from which a set of introduced lines covering the entire cotton genome was selected, and a total of 65 materials were used for backcrossing high-generation QTL analysis. Cotton leaf DNA was extracted for SSR molecular markers. The polymorphic primers between PD94042 and the yellow-brown cotton were screened out, and the population of the introduced lines of the yellow-brown cotton was scanned and QTL analyzed.

[0032] 1. Import family data analysis

[0033] (1) Genotype data statistics

[0034] Record the type of SSR markers of parents and offspring: the same as that of parents (P 1 ) the same homozygous band type is recorded as "1", and the parent (P 2 ) the same homozygous band typ...

Embodiment 2

[0049] Upland cotton PD94042 (P 1 ) as the recipient parent, G.mustelinum (P 2 ) as the donor parent, and upland cotton PD94042 (P 1 ) was backcrossed to the recurrent parent for three generations, and then self-crossed for three generations to construct a backcross high-generation population, from which a set of introduced lines covering the entire cotton genome was selected for QTL analysis of the backcross high-generation. Cotton leaf DNA was extracted, and the primers shown in the following table were used to carry out SSR molecular markers. The SSR molecular detection results were statistically consistent with the genotype data in Example 1, indicating that the primers shown in Table 1 were the specificity of the cotton fiber length-related QTL of the present invention SSR primers.

[0050] Table 1 Specific SSR Primers

[0051] Primer name

Primer sequence ((5'-3'))

BNL3580F

CTTGTTTACATTTCCCTTTCTTATACC

BNL3580R

CAAAGGCGAACTCTTCCAAA

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of plant genetics, in particular to a cotton fiber length-related quantitative trait locus (QTL) and application thereof. The cotton fiber length-related QTL qUHM-1-1 is positioned at chromosome 1, and the side adjacent marker of the cotton fiber length-related QTL qUHM-1-1 is BNL3580-BNL1667; the cotton fiber length-related QTL qUHM-22-1 is positioned at chromosome 22, and the side adjacent marker of the cotton fiber length-related QTL qUHM-22-1 is NAU3093-CICR345. The cotton fiber length-related QTL can be detected in two environments, and has stability which does not depend on the environment.

Description

technical field [0001] The invention relates to the field of plant genetics, in particular to a QTL related to cotton fiber length and its application. Background technique [0002] Quantitative trait loci (QTL) are some regions on the chromosome that affect quantitative traits. A quantitative trait is often affected by multiple quantitative trait loci distributed in different positions of the genome. So far, QTL mapping has been carried out by constructing segregating populations based on parental hybridization and association analysis. However, the current low-density genetic map and temporary isolates make the accuracy and stability of the detected QTLs lower than ideal, and there are few cotton fiber quality-related QTLs that can be applied to cotton molecular breeding. Contents of the invention [0003] The purpose of the present invention is to provide QTL related to cotton fiber length. [0004] Another object of the present invention is the specific SSR primers f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 汪保华庄智敏张咪黄芳高新岩周水娟
Owner NANTONG UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap