Supercharge Your Innovation With Domain-Expert AI Agents!

a biochip

A biochip and chip technology, applied in the direction of biomaterial analysis, instruments, measuring devices, etc., can solve the problems of many detection steps and long detection time, and achieve the effects of convenient use, low production cost and simple structure

Active Publication Date: 2019-07-23
杨华卫 +2
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Therefore, in the whole detection process of traditional chips, there are many detection steps and long detection time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • a biochip
  • a biochip
  • a biochip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] figure 1 A biochip 10 of one embodiment of the present invention is schematically shown. like figure 1 As shown, the biochip 10 of this embodiment includes a base 3 . In this embodiment, the base 3 is in the shape of an elongated plate with several holes 8 opened therein. The holes 8 are preferably arranged in an array. The biochip 10 also includes several chip handles 2 . In this embodiment, the chip handle 2 is an elongated cuboid, the number of which preferably corresponds to the number of the holes 8 one-to-one. Each chip handle 2 can be inserted into a corresponding hole 8 and held securely. It is easy to understand that various methods can be used to fix the chip handle 2 in the base 3 , such as snap-fitting, gluing, and the like. In an embodiment not shown, the chip handle 2 is detachably fixed to the base 3 .

[0038]According to the present invention, the biochip 10 further includes a chip reaction interface 1 for labeling the detection probe. The chip ...

example 1

[0046] In this example, using figure 1 The biochip shown is used for identification of human papillomavirus genotyping, specifically for detecting common types of HPV nucleic acids (HPV16, HPV18, HPV6, HPV11).

[0047] HPV16 and HPV18 are the most common high-risk human papillomaviruses, which cause cervical cancer in women; HPV6 and HPV11 are the most common low-risk human papillomaviruses, which cause condyloma acuminatum. There are already vaccines against these four types of HPV.

[0048] The following describes the use of figure 1 The biochips are shown to carry out the various steps of the method for human papillomavirus identification.

[0049] Step 1: Fabrication of the chip reaction interface with the HPV genotyping probe immobilized

[0050] Design and synthesis of each HPV probe:

[0051] HPV16 probe sequence: TTTTTTTTTCTGAAGTAGATATGGCAGC

[0052] HPV18 probe sequence: TTTTTTTTTTTTATTGCCCAGGTACAGGA

[0053] HPV6 probe sequence: TTTTTTTTTGGAAGATGTAGTTACGGA

[...

Embodiment 2

[0085] image 3 A biochip 11 of an embodiment of the present invention is schematically shown. like image 3 As shown, the biochip 11 of this embodiment includes a base 31 . In this embodiment, the base 31 is plate-shaped, and several holes 81 are opened therein. The holes 81 are preferably arranged in an array. The biochip 11 also includes several chip handles 21 . In this embodiment, the chip handle 21 is an elongated cuboid, the number of which preferably corresponds to the number of the holes 81 one-to-one. Each chip handle 21 can be inserted into a corresponding hole 81 and held securely. It is easy to understand that the chip handle 21 can be fixed in the base 31 in various ways, such as snap-fit, glue and the like. In a not-shown embodiment, the chip handle 21 is detachably secured to the base 31 .

[0086] According to the present invention, the biochip 11 further includes a chip reaction interface 12 for labeling the detection probe. The chip reaction interfac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a biological chip and belongs to the technical field of biological detection. The biochip includes: a base and several chip handles installed on the base in the form of an array, and the chip handles protrude from the base in parallel to each other in a direction perpendicular to the base, and a free chip handle arranged on each chip handle Chip reaction interface for labeling detection probes at the end. Using this biochip for detection, all samples, reaction solutions and washing solutions are pre-prepared and placed in the reaction tank, and there is no need to move back and forth to add or remove them. Just move the biochip back and forth between the reaction tanks. Can save a lot of detection steps and operation time.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a biological chip. Background technique [0002] In the detection of traditional membrane chips, each detection sample needs to be added to the chip wells or grooves one by one for incubation. Then, the incubated samples are removed one by one from the wells or wells of the chip, and the washing solution is sequentially added to the wells or wells for detection multiple times for washing. After washing, the reaction solution is sequentially added to the well or tank for reaction, and the reacted solution needs to be removed one by one. After removing the reacted liquid, the wells or wells used for detection need to be washed several times, and the liquids in the wells or wells or wells are removed and kept dry. After that, the liquid as the detection signal needs to be added one by one hole or groove one by one to carry out the reaction. After the reac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569G01N33/574
CPCG01N33/5695G01N33/56983G01N33/57438G01N2333/35
Inventor 杨华卫曾冀杨化莉
Owner 杨华卫
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com