Toluene Monooxygenase and Its Application in Biocatalytic Synthesis of Chiral Sulfoxide
A monooxygenase and phenylmethyl sulfoxide technology, applied in the field of molecular biology, can solve the problems of unsuitable green industrial production and lack of chiral sulfoxide synthase, etc., and achieve short reaction time, environmental friendliness and mild reaction conditions Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1: the acquisition of toluene monooxygenase gene, comprises the following steps:
[0026] Using genomic DNA as a template, using primers F: 5'- CCGGGGATCCGATGAGAAGTTTCTTTCAATC -3' and R: 5'- AATTGTCGACTTAGGAGTTCCGGCCGTCCG -3 for PCR amplification pm TOM-A gene; obtained by PCR amplification using primers F: 5'-CCGGAGATCTCATGTGGGAATACATCAAGTAC-3' and R: 5'-TTAACTCGAGGCCGCGAGCCAAGGAAGGAC-3' pm TOM-B gene. The PCR reaction system is as follows: 10.0 μL of 2×TaqPCR Master Mix, 1 μL of genomic DNA, 0.5 μL of upstream and downstream primers, ddH 2 O 8.0 μL. PCR reaction conditions: 95°C for 10 min; 30 cycles of 98°C for 10 s, 56°C for 30 s, and 72°C for 90 s; 72°C for 10 min. The PCR product was electrophoresed on a 1% agarose gel to verify whether a fragment conforming to the size of the target gene was obtained.
Embodiment 2
[0027] Embodiment 2: Toluene monooxygenase gene expression vector construction, comprises the following steps:
[0028] restriction endonuclease Bam H I and Sal I pair contains pm The DNA fragment of the TOM-A gene sequence and the vector pETDute-1 were subjected to double enzyme digestion, and the recovered target fragment and vector were digested. After ligation with T4 DNA ligase at 16 °C for 4 h, the ligation product was transformed into Escherichia coli DH5α. After culturing overnight, pick out the grown monoclonal colony and shake the bacteria and extract the plasmid, use Bam HI and Sal I pair of recombinant plasmid pETDute1- pm TOMA performs double enzyme digestion detection. Next, follow up with Bgl II and xho I pair pm TOM-B gene and pETDute1- pm After TOMA performed the same operation, the recombinant vector pETDute1- pm TOM, and undergo DNA sequencing to ensure the sequence is accurate. Finally, the positive recombinant plasmids with accurate s...
Embodiment 3
[0029] Embodiment 3: the acquisition of toluene monooxygenase recombinant protein
[0030] Will be stored in glycerol containing pETDute1- pm After activation of the genetically engineered bacteria BL21(DE3) with TOM plasmid, pick a single colony in 3 ml of liquid LB medium containing the corresponding antibiotics, culture with shaking at 37 °C for 12 h, and transfer to a fresh Culture OD in 50 mL LB liquid medium containing antibiotics, shaking at 37 °C at 250 rpm 600 0.6 (about 3 h), add IPTG with a final concentration of 0.2 mM, and induce culture at 25 °C and 160 rpm for 14 h. After induction, collect the cells by centrifugation at 8000 rpm / min for 5 min, resuspend the cells in PBS buffer, disrupt the cells by ultrasonic, and centrifuge at 15000 rpm for 5 min to remove cell debris, take the supernatant and mix with 5x loading buffer, and place in SDS-PAGE electrophoresis analysis was performed after heating in a constant temperature metal bath at 100 °C for 5 min. figu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More