Application of manY/levF gene segment to butanol production

A technology of gene fragments and production of butanol, applied in the field of bioengineering, can solve the problems of low utilization rate and restriction of sugar

Active Publication Date: 2018-05-04
DALIAN UNIV OF TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of real materials such as Jerusalem artichoke in the production of butanol by fermentation is restricted by the low utilization rate of sugar

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of manY/levF gene segment to butanol production
  • Application of manY/levF gene segment to butanol production
  • Application of manY/levF gene segment to butanol production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] This embodiment includes the following steps:

[0039] (1) Construction of manY / levF gene overexpression recombinant plasmid

[0040] Using Sangon Biotech (Shanghai Shenggong) Ezup Column Bacterial Genomic DNA Extraction Kit (Product No.: B518255) to extract Clostridium acetobutylicum C. acetobutylicum ATCC 824 (purchased from American TypeCulture Collection) genomic DNA, using primer: thl -F: GACAC CTGCAG TTTTTAACAAAAATATTGA (the underlined part is the restriction site of Pst I) and thl-R: GACAC GTC GAC TTCTTTCATTCTAACTAACCTC (the underlined part is the Sal I restriction site) amplifies the promoter nucleotide sequence of thiolase from genomic DNA (see SEQ ID NO.3 for the specific sequence), and the thiolase promoter obtained by PCR amplification The DNA fragment was double-digested with Pst I and Sal I, and the pIMP1 plasmid [Mermelstein L.D., Welker N.E., Bennett G.N., Papoutsakis E.T. Expression of cloned homologous fermentative genes in Clostridium acetobutylic...

Embodiment 2

[0045] Butanol is fermented by the recombinant bacterial strain, and the present embodiment comprises the following steps:

[0046] First activate the strains, the recombinant strain Clostridium acetobutylicum ATCC824 (pIMP1-thl-manY / levF) obtained in Example 1 and the empty plasmid strain C.acetobutylicum ATCC 824 (pIMP1-thl) and their starting wild Type strain C.acetobutylicum ATCC 824 were inoculated into the activation medium (containing 50μg / mL erythromycin resistance). In an anaerobic environment, culture statically at 37.5°C for 20 hours, inoculate the activated strains in the seed medium (containing 50 μg / mL erythromycin resistance) according to the inoculum amount of 10% (v / v), and in the shaker For cultivation, the cultivation temperature is 37.5° C., the rotational speed is 150 rpm, and the cultivation is carried out for 24 to 30 hours. Use Biotec-3BG-4 fermenter (Shanghai Baoxing Biological Equipment Engineering Co., Ltd.) for anaerobic fermentation, the amount of...

Embodiment 3

[0059] Overexpression of recombinant strains to produce butanol by fermentation, this embodiment includes the following steps:

[0060] First activate the bacterial species, the overexpressed recombinant strain Clostridium acetobutylicum ATCC824 (pIMP1-thl-manY / levF) obtained in Example 1 and the control empty plasmid bacterial strain C.acetobutylicum ATCC 824 (pIMP1-thl) and The starting wild-type strain C. acetobutylicum ATCC824 was inoculated into the activation medium (containing 50 μg / mL erythromycin resistance). Cultivate statically at 37.5°C for 20 hours in an anaerobic environment, inoculate the activated strains in the seed medium (containing 50 μg / mL erythromycin resistance) according to the inoculum amount of 10% (v / v), and culture in a shaker , the culture temperature is 37.5°C, the rotation speed is 150rpm, and the culture is 24-30h. Use Biotec-3BG-4 fermenter (Shanghai Baoxing Biological Equipment Engineering Co., Ltd.) for anaerobic fermentation, the amount of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a manY / levF gene segment to butanol production, and particularly relates to overexpression recombination clostridium for producing butanol at high yield as wellas a building method and application thereof. The manY / levF gene sequence is SEQ ID NO.1. The building method of the overexpression recombination clostridium comprises the following steps of (1) manY / levF gene overexpression recombination plasmid building; (2) overexpression recombination plasmid amplification; (3) overexpression recombination plasmid methylation; (4) manY / levF gene overexpressionrecombination bacterial strain building; (5) overexpression recombination bacterial strain butanol fermentation performance detection. The invention also comprises fermentation application of the overexpression recombination clostridium to butanol production. When the manY / levF gene is overexpressed in C.acetobutylicum ATCC 824, the utilization rate of glucose, fructose and jerusalem artichoke hydrolysate in ABE fermentation and the butanol yield can be obviously improved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to the application of manY / levF gene fragments in the production of butanol, in particular to overexpressed recombinant Clostridium with high butanol production and its construction method and application. Background technique [0002] Coal, petroleum, etc. are fossil fuels, which are non-renewable resources. Not only are their reserves very limited, but their combustion also causes serious pollution to the environment. New green, environmentally friendly and sustainable bio-energy has become the common demand of all countries in the world. The use of biomass resources for biofuel production is a way to solve the energy crisis. Biomass resources have the advantages of large annual output, renewable, green and environmental protection, and their applications are becoming more and more extensive. [0003] Bio-liquid fuels such as bio-diesel, bio-ethanol, and bio-butanol can part...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/12C12N15/74C12P7/16C12R1/145
CPCC12N9/12C12N15/74C12P7/16Y02E50/10
Inventor陈丽杰李颖吴又多
OwnerDALIAN UNIV OF TECH