Unlock instant, AI-driven research and patent intelligence for your innovation.

In situ overexpression vector pgv64 and its application

An overexpression and carrier technology, applied in the field of genetic engineering, to achieve efficient work, avoid false phenotypes, and easy to use

Active Publication Date: 2021-10-08
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

By constructing its own promoter to drive gene expression, the gene can be expressed at the in situ level, but the expression degree of this expression obviously depends on the expression strength of the gene promoter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In situ overexpression vector pgv64 and its application
  • In situ overexpression vector pgv64 and its application
  • In situ overexpression vector pgv64 and its application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0031] Another embodiment of the present invention provides a method for preparing the above-mentioned in situ overexpression vector pGV64, comprising the following steps: synthesizing a T vector containing the nucleotide sequence GV64, and the two ends of the nucleotide sequence GV64 contain SacI and BglII restriction sites , the above T vector and pCAMBIA3301 vector were digested with Sac I and Bgl II respectively, and the digested fragments were ligated under the catalysis of T4 ligase to obtain vector pGV64.

[0032] Another embodiment of the present invention provides the application of the above-mentioned in situ overexpression vector pGV64 in regulating the in situ overexpression of Arabidopsis genes.

Embodiment 1

[0034] Construction of embodiment 1 vector pGV64

[0035] (1) Using gene synthesis technology to synthesize GV64-T, the nucleotide sequence GV64 containing the above-mentioned functional elements is connected to the T vector (both ends contain SacI and BgIII restriction endonuclease sites), and the sequence of GV64 is as SEQ ID No As shown in :10, the size is 1389bp.

[0036] (2) SacⅠ and BglⅡ digestion:

[0037] The GV64-T (100ng / μL) and pCAMBIA3301 (100ng / μL) vectors were digested with SacⅠ and BglⅡ respectively, the method is as follows:

[0038] Establish enzyme digestion system (100μL):

[0039] name Amount added SacⅠ(BglⅡ) 2.4 μL carrier 15μL 10×NEB buffer 10μL Ultra-pure water Make up to 100μL

[0040] React at 37°C for 3 hours.

[0041] See pCAMBIA3301 Vector Schematic figure 1 .

[0042] After the reaction, 1.2% agarose gel electrophoresis, and use the gel recovery kit (Quanshijin Biotechnology Co., Ltd.) to cut the gel ...

Embodiment 2

[0050] Example 2 Functional verification of in situ overexpression vector pGV64

[0051] 1. Construction of proIDA-pGV64 vector

[0052] (1) Amplify the IDA gene promoter sequence

[0053] Take the Arabidopsis col that has grown for 20 days, and take the leaves to extract genomic DNA. Using this as a template, the sequence of the amplification primers is as follows:

[0054] GV64_PROMOTER_IDAF:ATGATTACGAATTCGAGCTCAACCCTCGTTCTGAATCAAAGGGT;

[0055] GV64_PROMOTER_IDAR:CCTCAGATCTGGATCCTTGGTAGTCAATGTTTTTTTTCTTCTC;

[0056] Set the amplification program, and use the PCR instrument to amplify the target fragment: 95°C for 3 minutes, (95°C for 30s, 56°C for 30s, 72°C for 1min30s) for 32 cycles, 72°C for 10 minutes, and keep warm at 25°C;

[0057] The PCR product was subjected to gel electrophoresis and gel-cutting to recover (using Quanshijin's kit) to obtain the purified IDA promoter fragment.

[0058] (2) Use the infusion enzyme system to connect the IDA promoter fragment into ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an in situ overexpression vector pGV64 and its application, which belongs to the field of genetic engineering. It uses the effective combination of Omega sequence, 4×VP16, GAL4 and other elements to convert gene expression into transcription factor activation. The self-promoter drives the expression of the trans-acting factor GAL4-BD fusion VP64, thereby promoting the expression level of the gene itself and enhancing the expression level of the gene in situ. The in situ overexpression vector pGV64 includes the pCAMBIA3301 vector and the following functional elements connected in cis: OMega, the sequence is shown in SEQ ID No: 1; Kozak, the sequence is shown in SEQ ID No: 2; 3×Flag, the sequence As shown in SEQ ID No:3; GAL4‑BD, the sequence is shown in SEQ ID No:4; NLS, the sequence is shown in SEQ ID No:5; VP64, the sequence is shown in SEQ ID No:6; Nos‑Terminal ‑5XUAS, the sequence is shown in SEQ ID No:7; minimal 35S, the sequence is shown in SEQ ID No:8; 4×MYC, the sequence is shown in SEQ ID No:9.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an in situ overexpression vector pGV64 and its application. Background technique [0002] Overexpression refers to a technology that significantly increases the expression of the gene under study through some techniques. As a research method, overexpression has an important application in the process of gene function analysis. At present, in the study of plant gene function, constitutive promoters are usually used to drive gene overexpression, such as tobacco mosaic virus CaMV 35S, maize ubiquitin promoter ubi, plant housekeeping gene promoter actin, etc. This type of promoter has the characteristics of high expression, but the disadvantage of constitutive promoter is that it cannot control the position of gene expression, so that the overexpressed gene has no selectivity in tissue specificity, resulting in ectopic expression of the gene. The result of ectopic expression is th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/66A01H5/00A01H6/20
CPCC12N15/66C12N15/8216
Inventor 张增林郭永峰李伟高晓明徐萌萌
Owner TOBACCO RES INST CHIN AGRI SCI ACAD