In situ overexpression vector pgv64 and its application
An overexpression and carrier technology, applied in the field of genetic engineering, to achieve efficient work, avoid false phenotypes, and easy to use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0031] Another embodiment of the present invention provides a method for preparing the above-mentioned in situ overexpression vector pGV64, comprising the following steps: synthesizing a T vector containing the nucleotide sequence GV64, and the two ends of the nucleotide sequence GV64 contain SacI and BglII restriction sites , the above T vector and pCAMBIA3301 vector were digested with Sac I and Bgl II respectively, and the digested fragments were ligated under the catalysis of T4 ligase to obtain vector pGV64.
[0032] Another embodiment of the present invention provides the application of the above-mentioned in situ overexpression vector pGV64 in regulating the in situ overexpression of Arabidopsis genes.
Embodiment 1
[0034] Construction of embodiment 1 vector pGV64
[0035] (1) Using gene synthesis technology to synthesize GV64-T, the nucleotide sequence GV64 containing the above-mentioned functional elements is connected to the T vector (both ends contain SacI and BgIII restriction endonuclease sites), and the sequence of GV64 is as SEQ ID No As shown in :10, the size is 1389bp.
[0036] (2) SacⅠ and BglⅡ digestion:
[0037] The GV64-T (100ng / μL) and pCAMBIA3301 (100ng / μL) vectors were digested with SacⅠ and BglⅡ respectively, the method is as follows:
[0038] Establish enzyme digestion system (100μL):
[0039] name Amount added SacⅠ(BglⅡ) 2.4 μL carrier 15μL 10×NEB buffer 10μL Ultra-pure water Make up to 100μL
[0040] React at 37°C for 3 hours.
[0041] See pCAMBIA3301 Vector Schematic figure 1 .
[0042] After the reaction, 1.2% agarose gel electrophoresis, and use the gel recovery kit (Quanshijin Biotechnology Co., Ltd.) to cut the gel ...
Embodiment 2
[0050] Example 2 Functional verification of in situ overexpression vector pGV64
[0051] 1. Construction of proIDA-pGV64 vector
[0052] (1) Amplify the IDA gene promoter sequence
[0053] Take the Arabidopsis col that has grown for 20 days, and take the leaves to extract genomic DNA. Using this as a template, the sequence of the amplification primers is as follows:
[0054] GV64_PROMOTER_IDAF:ATGATTACGAATTCGAGCTCAACCCTCGTTCTGAATCAAAGGGT;
[0055] GV64_PROMOTER_IDAR:CCTCAGATCTGGATCCTTGGTAGTCAATGTTTTTTTTCTTCTC;
[0056] Set the amplification program, and use the PCR instrument to amplify the target fragment: 95°C for 3 minutes, (95°C for 30s, 56°C for 30s, 72°C for 1min30s) for 32 cycles, 72°C for 10 minutes, and keep warm at 25°C;
[0057] The PCR product was subjected to gel electrophoresis and gel-cutting to recover (using Quanshijin's kit) to obtain the purified IDA promoter fragment.
[0058] (2) Use the infusion enzyme system to connect the IDA promoter fragment into ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com