Application of human PLEKHO1 gene and related medicines thereof
A gene and drug technology, applied in the application of PLEKHO1 gene and related drugs, can solve the problem that the relationship between PLEKHO1 gene and tumor has not been reported yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1. Preparation of RNAi lentivirus against human PLEKHO1 gene
[0069] 1) Screening for effective siRNA targets against the human PLEKHO1 gene
[0070] Retrieve PLEKHO1 (NM_015904) gene information from Genbank; design effective siRNA targets for PLEKHO1 gene. Table 1 lists one of the effective siRNA target sequences for the PLEKHO1 gene.
[0071] Table 1 is targeted at the siRNA target sequence of human PLEKHO1 gene
[0072] SEQ ID NO
TargetSeq
1
gagctgagagacctgtacaga
[0073] 2) Preparation of lentiviral vector
[0074] For the siRNA target (SEQ ID NO:1), synthesize a double-stranded DNA Oligo sequence with sticky ends containing Age I and EcoR I restriction sites at both ends, as shown in Table 2; act on pGCSIL with Age I and EcoR I restriction endonucleases -GFP vectors such as figure 1 As shown, it was linearized, and the digested fragments were identified by agarose gel electrophoresis.
[0075] Table 2 Double-stranded DNA ...
Embodiment 2
[0097] Example 2. Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of PLEKHO1 gene
[0098] Human lung cancer H1299 cells and glioma U87 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 2×10 5 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, H1299:20, U87:20) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 3 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV operation manual of Promega Company, RNA was reverse-transcribed to obtain cDNA. The reverse transcription reaction system is shown in Table 7, reacted at 42°C for 1 hour, and then bathed in a water bath at 70°...
Embodiment 3
[0111] Example 3. Detection of proliferation ability of tumor cells infected with PLEKHO1-siRNA lentivirus
[0112] Human lung cancer H1299 cells and glioma U87 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, H1299:20, U87:20), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells in each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 3-5 replicate wells per group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate ...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap