Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of human PLEKHO1 gene and related medicines thereof

A gene and drug technology, applied in the application of PLEKHO1 gene and related drugs, can solve the problem that the relationship between PLEKHO1 gene and tumor has not been reported yet

Inactive Publication Date: 2018-07-31
上海滴英生物医药科技有限公司
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the relationship between the PLEKHO1 gene and tumors has not been reported in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human PLEKHO1 gene and related medicines thereof
  • Application of human PLEKHO1 gene and related medicines thereof
  • Application of human PLEKHO1 gene and related medicines thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1. Preparation of RNAi lentivirus against human PLEKHO1 gene

[0069] 1) Screening for effective siRNA targets against the human PLEKHO1 gene

[0070] Retrieve PLEKHO1 (NM_015904) gene information from Genbank; design effective siRNA targets for PLEKHO1 gene. Table 1 lists one of the effective siRNA target sequences for the PLEKHO1 gene.

[0071] Table 1 is targeted at the siRNA target sequence of human PLEKHO1 gene

[0072] SEQ ID NO

TargetSeq

1

gagctgagagacctgtacaga

[0073] 2) Preparation of lentiviral vector

[0074] For the siRNA target (SEQ ID NO:1), synthesize a double-stranded DNA Oligo sequence with sticky ends containing Age I and EcoR I restriction sites at both ends, as shown in Table 2; act on pGCSIL with Age I and EcoR I restriction endonucleases -GFP vectors such as figure 1 As shown, it was linearized, and the digested fragments were identified by agarose gel electrophoresis.

[0075] Table 2 Double-stranded DNA ...

Embodiment 2

[0097] Example 2. Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of PLEKHO1 gene

[0098] Human lung cancer H1299 cells and glioma U87 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 2×10 5 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, H1299:20, U87:20) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 3 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV operation manual of Promega Company, RNA was reverse-transcribed to obtain cDNA. The reverse transcription reaction system is shown in Table 7, reacted at 42°C for 1 hour, and then bathed in a water bath at 70°...

Embodiment 3

[0111] Example 3. Detection of proliferation ability of tumor cells infected with PLEKHO1-siRNA lentivirus

[0112] Human lung cancer H1299 cells and glioma U87 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, H1299:20, U87:20), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells in each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 3-5 replicate wells per group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of a human PLEKHO1 gene and related medicines thereof, and discloses application of the human PLEKHO1 gene in tumor treatment and medicine preparation. A human PLEKHO1 gene small interfering RNA, a human PLEKHO1 gene interfering nucleic acid constructor and human PLEKHO1 gene interfering lentivirus are further constructed, and application of the human PLEKHO1 gene small interfering RNA, the human PLEKHO1 gene interfering nucleic acid constructor and the human PLEKHO1 gene interfering lentivirus are disclosed. The siRNA or the nucleic acid constructor containing the siRNA sequence and the lentivirus can specifically inhibit the expression of the human PLEKHO1 gene, especially the lentivirus, can efficiently infect target cells, efficiently inhibits the expression of the PLEKHO1 gene in the target cells, then inhibits the growth of tumor cells, promotes tumor cell apoptosis and has important significance in tumor treatment.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the use of the PLEKHO1 gene and related medicines. Background technique [0002] RNA interference (RNA interference, RNAi) is the use of short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically cause RNAi at the transcriptional and post-transcriptional levels (Tuschl T, Zamore PD, Sharp PA, Bartel DP.RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23nuc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N7/01C12Q1/6886A61K31/713A61K31/7088A61P35/00
CPCC12N15/113A61P35/00C12N7/00C12N15/86C12N2310/14C12N2740/15021C12N2740/15043C12N2800/107C12Q1/6886C12Q2600/136C12Q2600/158C12N2310/531
Inventor 陈新页
Owner 上海滴英生物医药科技有限公司