A method of producing chimeric antigen receptor modified gamma delta t cells

A chimeric antigen receptor, cell technology

Active Publication Date: 2020-02-14
HEBEI SENLANG BIOTECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although the natural activity of γδ T cells makes it an excellent carrier for CAR-T cell therapy, there is no CAR-modified γδ T cell yet due to the limitations of low cell content, difficulty in large-scale expansion in vitro, and low transfection rate. Reports of successful clinical application of cells
Traditional γδ T cell expansion techniques in vitro, including solid-phase anti-pan TCRγδ antibody expansion, or using IPP / HMBPP / ZOL to selectively expand Vγ9δ2T cells, are all expanded from peripheral mononuclear cells (PBMC). Due to the low proportion of γδ T cells, gene transfection is interfered by other irrelevant cells, resulting in low transfection efficiency
In addition, the final product expanded from PBMC has low purity and is easy to mix with αβ T cells, which is not conducive to the development of general CAR-T products
Sorting and purifying γδ T cells can solve the above problems, but without the assistance of other cells, the activation and expansion efficiency will be greatly reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of producing chimeric antigen receptor modified gamma delta t cells
  • A method of producing chimeric antigen receptor modified gamma delta t cells
  • A method of producing chimeric antigen receptor modified gamma delta t cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1. A method for expanding γδ T cells

[0071] 1. Construction of K562-shFPPS tumor cell line with reduced expression of FPPS

[0072] 1. Construction of lentiviral recombinant plasmid

[0073] (1) Preparation of recombinant plasmid

[0074] The U6-based shRNA construction system of the Vectorbuilder system of Saiye Biotechnology Co., Ltd. was used to construct the lentiviral recombinant plasmid. Specific steps are as follows:

[0075] Design and synthesize a specific shRNA coding sequence targeting FPPS (shFPPS) as the experimental group: CCAGCAGTGTTCTTGCAATATCTCGAGATATTGCAAGAACACTGCTGG (sequence 1); wherein, the bold 6bp sequence in the middle is the stem-loop sequence, its left 21bp is the sense sequence, and the right The 21bp sequence is an antisense sequence; at the same time, the following Scramble-shRNA coding sequence (shSRB) was synthesized as a negative control group: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG; among them, the 6bp sequence in ...

Embodiment 2

[0115] Example 2, Production method of CAR-γδ T cells

[0116] 1. Preparation of CAR22 lentiviral particles

[0117] The present invention uses the CAR structure to genetically modify γδ T cells, and the CAR structure from the amino terminal to the carboxyl terminal is as follows: ScFv(CD22)-Hinge(CD8)-TM(CD8)-CD137-CD3ζ, that is, from the amino terminal to the carboxyl terminal The sequence is: single-chain variable region derived from CD22 monoclonal antibody (clone number: M971), CD8a hinge region and transmembrane region, CD137 signal domain and CD3ζ chain intracellular region. Its amino acid sequence is shown in sequence 3 of the sequence listing, and its nucleotide sequence is shown in sequence 4 of the sequence listing. Insert the DNA molecule shown in Sequence 4 into the Senl_pLenti-EF1 vector (the Senl_pLenti-EF1 vector is a vector obtained by adding restriction sites PacI and SpeI on both sides of the original plasmid cloning site, and the original plasmid name is L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing chimeric antigen receptor modified γδT cells. In the present invention, shFPPS targeting FPP synthetase is transfected into K562 cells through a lentiviral vector, down-regulates the expression level of FPPS in K562 cells, and constructs a K562-shFPPS cell line with reduced expression level of FPPS. In the present invention, the K562-shFPPS cell line is added into the γδT cell culture system for co-cultivation with the γδT cells, and it is found that the K562-shFPPS cell line can promote the in vitro differentiation and expansion of the γδT cells. In the present invention, the lentiviral vector expressing CAR was also added to the γδT cell culture system containing the cell line for co-cultivation, and it was found that the K562-shFPPS cell line can also effectively increase the transfection rate of the CAR gene. The solution provided by the present invention effectively solves the technical bottleneck of large-scale production of CAR-γδT cells, and has good application prospects.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for producing chimeric antigen receptor-modified γδ T cells. Background technique [0002] Adoptive cellular immunotherapy is to infuse in vitro cultured, activated, and genetically modified autologous or allogeneic immune cells to patients to exert anti-tumor activity. Chimeric Antigen Receptor (CAR) modified T cell therapy technology (CAR-T technology) is to modify immune effector cells through genetic engineering technology, so that the modified cells can specifically recognize and kill cells expressing specific antigens. Target cells, so as to achieve the purpose of specifically eliminating tumor cells. CAR-T cells that specifically target the B lymphocyte surface marker CD19 molecule have the most significant curative effect in the treatment of B lymphocyte malignancies, and can achieve complete remission in 90% of relapsed and refractory B-lineage acute lymphoblastic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N5/0784C12N15/867
CPCC12N5/0639C12N15/86C12N2740/15043C07K14/7051C12N5/0636C12N2510/00C12N2502/30C12N2502/99C12N2501/2302C12N2740/16043C12N15/1137C12N2310/14C12N2310/531C12Y205/0101C07K14/70517C07K14/70578C07K14/7056C12N9/1085C07K2319/00C07K2319/03C07K2319/30C07K2319/33A61K39/001113A61K35/17C12N15/115C12N15/85C12N2740/15041
Inventor李建强王庆龙王琳
OwnerHEBEI SENLANG BIOTECH CO LTD