Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polypeptide that specifically binds to EGFR and inhibits EGF to promote tumor cell proliferation

A cell proliferation and specific technology, applied in the field of peptides that specifically bind to EGFR to inhibit EGF to promote tumor cell proliferation, can solve the problem that small molecule inhibitors are not as specific as monoclonal antibodies, patients cannot afford high costs for a long time, application limitations, etc. problems, to achieve the effect of easy large-scale production, low production cost, and short polypeptide sequence

Active Publication Date: 2021-08-03
JIANGSU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, EGFR antibody drugs that have been marketed in my country include cetuximab, panitumumab, and nimotuzumab. Although these drugs have significant curative effects and fewer side effects, they are all very expensive, and patients cannot Bear high costs, and its application is also limited
The mechanism of action of small molecule inhibitors is different from that of monoclonal antibodies, mainly by competitively binding to the phosphorylation site of EGFR intracellular tyrosine kinase, blocking its interaction with ATP, and then inhibiting EGFR tyrosine phosphorylation And a series of downstream signal transduction, so small molecule inhibitors are not as specific as monoclonal antibodies, and patients will experience side effects such as diarrhea, rash, and nausea during use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide that specifically binds to EGFR and inhibits EGF to promote tumor cell proliferation
  • Polypeptide that specifically binds to EGFR and inhibits EGF to promote tumor cell proliferation
  • Polypeptide that specifically binds to EGFR and inhibits EGF to promote tumor cell proliferation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1: Construction of pET-30a / EGFR-ECD protein expression vector

[0025] Obtain the sequence information of EGFR from Genebank, accession number is CCDS5514.1, a total of 3363bp. EGFR extracellular domain (Extracellular Domain) is one of them (aa25-645), a total of 1863bp, extract the DNA sequence encoding EGFR-ECD fragment from the entire sequence of EGFR, as shown in SEQ.ID.NO.2, and design PCR based on it Primers:

[0026] Forward primer (SEQ.ID.NO.3):

[0027] 5'-GCTGATATC GGATCC ATGCTGGAGGAAAAGAAAGT-3'

[0028] and reverse primer (SEQ.ID.NO.4):

[0029] 5'-ACGGAGCTC GAATTCTCAGGACGGGATCTT AGG-3', the underlined parts are the restriction sites Bam HI and Eco RI at both ends respectively. The PCR product of EGFR-ECD and vector pET-30a (Novagen, #69909-3) were digested with Bam HI and Eco RI at 37 °C for 1 h, then ligated with T4 DNA ligase at 16 °C for 12 h. Transform the ligation product into DH5α competent cells (full gold, CD201), wait for a singl...

Embodiment 2

[0031] Example 2: Induced expression and refolding purification of EGFR-ECD

[0032] Induced expression of EGFR-ECD: Transform the successfully constructed recombinant plasmid pET-30a / EGFR-ECD into the host strain BL21(DE3) (full gold), use the kanamycin resistance plate to screen the recombinants, pick a single colony in Cultured in LB liquid medium containing kanamycin for 10 h. The culture was inoculated into LB liquid medium at a volume ratio of 1:100, and cultured with vigorous shaking at 37 °C until OD 600 =0.5~0.6, add 0.1 M IPTG to make the final concentration 0.5 mM, and induce at 25 °C for 4 h.

[0033] Verification of the expression of the target protein: centrifuge the above-mentioned induced bacterial solution at 5000 rpm for 10 min, remove the supernatant, and resuspend the bacteria in the lysate (50 mM Tris- HCl pH7.5, 500 mMNaCl, 10% glycerol, 1% TritonX-100, 1 mM protease inhibitor PMSF, 1 mg / mL lysozyme), put on ice and sonicate at 200 W power for 3 s wit...

Embodiment 3

[0038] Example 3: Phage display panning for biologically active peptides specifically binding to EGFR

[0039] Immobilization of target molecules: Add 100 µL of target molecule EGFR-ECD protein solution (0.1 MTBS pH7.4) at a concentration of 100 µg / mL into a 96-well plate, place on a shaker and incubate at 4 °C in a humidified container overnight. The target molecule solution was removed and washed 6 times with TBST (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% [v / v] Tween-20). Finally, block solution (0.1 M NaHCO 3 pH 8.6, 5 mg / mL BSA, 0.02% NaN 3 ) closed for 1 h.

[0040] Binding of phage random peptide library to target molecules: Remove the blocking solution and wash 10 times with TBST (containing 0.1% [v / v] Tween-20). Phage library (NEB (Beijing) Co., Ltd., Ph.D.-7 Phage Display Peptide Library Kit, Cat. No. #E8100S) or amplified phage diluted with TBST (containing 0.1% [v / v] Tween-20) , the titer of phage was 10 9 ~10 11 In between, the diluted phage was added to th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a polypeptide that competitively binds to EGFR to inhibit the proliferation of EGF and promote tumor cell proliferation, and belongs to the technical field of biomedicine; the invention uses the extracellular domain EGFR-ECD of epidermal growth factor receptor as a target molecule, and is panned by phage display technology , using EGF as the active ingredient to specifically elute the phage binding to the target molecule, and obtain the biologically active polypeptide TUZG14; as confirmed by the present invention, the biologically active polypeptide TUZG14 significantly inhibits the proliferation process of gastric cancer cells caused by EGF; the polypeptide sequence of the present invention is relatively Short, easy to synthesize and achieve large-scale production, can inhibit the cancer-promoting effect of EGF, has the potential of subsequent development as an anticancer drug, and has important application value in the research and development of anticancer drugs.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a polypeptide that specifically binds to EGFR and inhibits EGF from promoting tumor cell proliferation. Background technique [0002] Epidermal Growth Factor Receptor EGFR (Epidermal Growth Factor Receptor) belongs to Type epidermal growth factor family (ie ErbB family). EGFR is a glycoprotein receptor on the surface of the cell membrane, which consists of 1186 amino acid residues, has a molecular weight of 170KD, and has tyrosine kinase activity. EGFR can be divided into three parts in structure: ①Extracellular region: 621 amino acid residues, which binds to its ligand; ②Transmembrane region: 23 amino acid residues form an α-helical structure, which fixes the receptor on the cell membrane Upper; ③Intracellular region: 542 amino acid residues, containing typical ATP binding sites and tyrosine kinase phosphorylation sites, responsible for the activation of downstream pathways...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/06A61K38/08A61P35/00
CPCA61K38/00A61P35/00C07K7/06
Inventor 屠志刚沈明香卢子文刘晗青张雅菲
Owner JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com