Polypeptide that specifically binds to EGFR and inhibits EGF to promote tumor cell proliferation
A cell proliferation and specific technology, applied in the field of peptides that specifically bind to EGFR to inhibit EGF to promote tumor cell proliferation, can solve the problem that small molecule inhibitors are not as specific as monoclonal antibodies, patients cannot afford high costs for a long time, application limitations, etc. problems, to achieve the effect of easy large-scale production, low production cost, and short polypeptide sequence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1: Construction of pET-30a / EGFR-ECD protein expression vector
[0025] Obtain the sequence information of EGFR from Genebank, accession number is CCDS5514.1, a total of 3363bp. EGFR extracellular domain (Extracellular Domain) is one of them (aa25-645), a total of 1863bp, extract the DNA sequence encoding EGFR-ECD fragment from the entire sequence of EGFR, as shown in SEQ.ID.NO.2, and design PCR based on it Primers:
[0026] Forward primer (SEQ.ID.NO.3):
[0027] 5'-GCTGATATC GGATCC ATGCTGGAGGAAAAGAAAGT-3'
[0028] and reverse primer (SEQ.ID.NO.4):
[0029] 5'-ACGGAGCTC GAATTCTCAGGACGGGATCTT AGG-3', the underlined parts are the restriction sites Bam HI and Eco RI at both ends respectively. The PCR product of EGFR-ECD and vector pET-30a (Novagen, #69909-3) were digested with Bam HI and Eco RI at 37 °C for 1 h, then ligated with T4 DNA ligase at 16 °C for 12 h. Transform the ligation product into DH5α competent cells (full gold, CD201), wait for a singl...
Embodiment 2
[0031] Example 2: Induced expression and refolding purification of EGFR-ECD
[0032] Induced expression of EGFR-ECD: Transform the successfully constructed recombinant plasmid pET-30a / EGFR-ECD into the host strain BL21(DE3) (full gold), use the kanamycin resistance plate to screen the recombinants, pick a single colony in Cultured in LB liquid medium containing kanamycin for 10 h. The culture was inoculated into LB liquid medium at a volume ratio of 1:100, and cultured with vigorous shaking at 37 °C until OD 600 =0.5~0.6, add 0.1 M IPTG to make the final concentration 0.5 mM, and induce at 25 °C for 4 h.
[0033] Verification of the expression of the target protein: centrifuge the above-mentioned induced bacterial solution at 5000 rpm for 10 min, remove the supernatant, and resuspend the bacteria in the lysate (50 mM Tris- HCl pH7.5, 500 mMNaCl, 10% glycerol, 1% TritonX-100, 1 mM protease inhibitor PMSF, 1 mg / mL lysozyme), put on ice and sonicate at 200 W power for 3 s wit...
Embodiment 3
[0038] Example 3: Phage display panning for biologically active peptides specifically binding to EGFR
[0039] Immobilization of target molecules: Add 100 µL of target molecule EGFR-ECD protein solution (0.1 MTBS pH7.4) at a concentration of 100 µg / mL into a 96-well plate, place on a shaker and incubate at 4 °C in a humidified container overnight. The target molecule solution was removed and washed 6 times with TBST (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% [v / v] Tween-20). Finally, block solution (0.1 M NaHCO 3 pH 8.6, 5 mg / mL BSA, 0.02% NaN 3 ) closed for 1 h.
[0040] Binding of phage random peptide library to target molecules: Remove the blocking solution and wash 10 times with TBST (containing 0.1% [v / v] Tween-20). Phage library (NEB (Beijing) Co., Ltd., Ph.D.-7 Phage Display Peptide Library Kit, Cat. No. #E8100S) or amplified phage diluted with TBST (containing 0.1% [v / v] Tween-20) , the titer of phage was 10 9 ~10 11 In between, the diluted phage was added to th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



