Application of Tomato samdc1 Gene in Breeding Seedless Tomato

A tomato and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of unclear specific functions, and achieve the effect of easy operation and wide application prospects.

Active Publication Date: 2021-05-04
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that simultaneous silencing of three SAMDC homologues in the tomato tapetum results in male sterility (Ranjita Sinha et al., Plant Mol Biol (2013) 82:169-180), but there are 5 homologues in the tomato SAMDC family Genes, their specific functions are not clear, and it has not been reported that seedless tomato can be obtained by knocking out a single gene by gene knockout

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Tomato samdc1 Gene in Breeding Seedless Tomato
  • Application of Tomato samdc1 Gene in Breeding Seedless Tomato
  • Application of Tomato samdc1 Gene in Breeding Seedless Tomato

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Tomato SAMDC1 Gene Knockout Vector and Agrobacterium tumefaciens Engineering Bacteria Construction

[0039] 1. Construction of tomato SAMDC1 gene knockout vector

[0040] Use the http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR website to design the target sequence of the SAMDC1 gene, sgRNA (GCTCGACTCGGACAGCACAT), add appropriate bases, and synthesize two primers (SlSAMDC1F and SlSAMDC1R in Table 1) , anneal it into double strands, and insert the annealed double strand gRNA into the BbsI restriction site of the AtU6-sgRNA-AtUBQ-Cas9 carrier; double-enzyme cut the AtU6-sgRNA-AtUBQ-Cas9 carrier with HindIII and KpnI, tap the rubber to recover large fragments; ligate On pCambia1301, a tomato SAMDC1 knockout vector was obtained, named Ksamdc1, which was sequenced by General Biosystems (Anhui) Co., Ltd.

[0041] Table 1 Tomato SlSAMDC1 Knockout Primer Sequence List

[0042]

[0043] 2. Construction of Agrobacterium tumefaciens Engineering Strain A Containing Tomato SAMDC...

Embodiment 2

[0045] Embodiment 2 Construction of mutant plants of tomato SAMDC1 gene knockout

[0046] 1. Cultivate sterile vaccines

[0047] Soak wild-type tomato (Alisa Craig) seeds in tap water (or use a shaker at 28°C 200r / min) for 6-8h, then sterilize them with 75% alcohol for 30sec, and then sterilize them in 10% NaClO for 15min (use a shaker at 28°C 200r / min). / min), washed with sterilized distilled water for 3 times and transferred to a sterilized vessel, inoculated in 1 / 2MS medium. Cultivate under dark conditions at 25°C until germination, and transfer to a light cultivation room. The seedling growth conditions are 25°C, 16h light / 8h darkness, and light intensity 1800lx ( figure 1 ).

[0048] 2. Prepare explants and culture Agrobacterium

[0049] 6 days after the seeds germinate, cut off the cotyledons of the sterile seedlings with a knife. The cotyledons have a small petiole, and put them in the nursing medium KCMS for pre-cultivation for 1 day (avoid light, just overnight. If...

Embodiment 3

[0057] Example 3 Constructing mutant plants of tomato SAMDC1 gene knockout

[0058] The tomato SAMDC1 gene knockout plants obtained in Example 2 and the wild-type tomato (Alisa Craig) were placed in the multi-span greenhouse of Nanjing Agricultural University Pailou Base to be cultivated respectively, and the fruits were harvested when they matured late, and the fruits were cut open from the middle and observed. Seed condition. The result is as Figure 5-6 shown.

[0059] The results showed that, compared to wild-type tomato fruit ( Figure 5 A, Figure 6 A), the tomato fruit with SAMDC1 gene knockout becomes smaller, and there is a protrusion at the navel ( Figure 5 B), without a seed inside ( Figure 6 B), confirming that seedless tomato can be obtained by knocking out the SAMDC1 gene.

[0060] The present invention has determined the specific function of the tomato SAMDC1 gene. Through the research of the present invention, it has been found that knocking out the tom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides the application of tomato SAMDC1 gene in cultivating seedless tomato, a seedless tomato cultivating method, and the application of the method in cultivating seedless tomato. The method comprises the following steps: S1: constructing Agrobacterium tumefaciens engineering strain A containing a tomato SAMDC1 gene knockout vector; S2: transforming tomato explants mediated by the Agrobacterium tumefaciens engineering strain A obtained in S1, and preparing a SAMDC1 gene knockout S3: The SAMDC1 gene-knockout tomato plants obtained in S2 were planted in a greenhouse to cultivate seedless tomato fruits. The specific function of the tomato SAMDC1 gene has been determined. Through the research of the present invention, it has been found that knocking out the tomato SAMDC1 gene alone can realize the seedless character of tomato fruit. The knockout of this gene can be used as a method for cultivating seedless tomatoes and applied to seedless tomatoes cultivation. The invention provides a theoretical basis for tomato molecular assisted breeding, is easy to operate and has wide application prospects.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of tomato SAMDC1 gene in cultivating seedless tomato. Background technique [0002] Tomato is the vegetable crop with the largest planting area in my country's vegetable industry. It is a self-pollinating crop with obvious heterosis. At present, hybrid seeds are mainly used in tomato production. When hybrid seeds are bred, most of them are artificially detasselled and pollinated. However, due to their small flower organs, manual detasselling is more difficult, and self-seeds are often mixed in, which affects the purity of hybrid seeds. . In the conventional hybrid seed production process, manual detasseling requires a lot of labor, which is not only time-consuming but also laborious. [0003] Polyamines are a class of low molecular weight aliphatic nitrogenous bases that widely exist in living organisms and have strong biological ac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/60C12N9/88C12N15/84A01H5/10A01H6/82
CPCC12N9/88C12N15/8261C12Y401/0105
Inventor 王玉张月美钟珉郭世荣王健孙锦束胜
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap