Mutant of D-allulose 3-epimerase and application of mutant

An epimerase and psicose technology, applied in the fields of genetic engineering and enzyme engineering, can solve the problems of poor temperature stability, unsuitable for industrial production, low fructose catalytic activity, etc., and achieve conversion rate improvement and temperature stability. The effect of improving and improving catalytic activity

Active Publication Date: 2019-11-01
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF9 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current DAE enzyme has low catalytic activity on fructose and poor temperature stability, which is not suitable for industrial production of D-psicose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant of D-allulose 3-epimerase and application of mutant
  • Mutant of D-allulose 3-epimerase and application of mutant
  • Mutant of D-allulose 3-epimerase and application of mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of D-psicose-3-epimerase mutants

[0035] (1) AgDAE-pET-28a plasmid (Suzhou Jin Weizhi Biotechnology Co., Ltd.) was used as a template, and random mutations were performed using the GeneMorph II random mutation kit (Cat. No.: 200550) from Agilent Technologies.

[0036] (2) Amplify the AgDAE gene by the following primers

[0037] Primer (5'-3')AgDAE-F:

[0038] GGAATTCCATATGAAAATTGGCTGTCATGGTCTG,

[0039] Primer (5'-3')AgDAE-R:

[0040] CCGCTCGAGT TAATGCAGCT CGATGGTCTT GATTG,

[0041] The AgDAE gene fragment of about 870bp was amplified by error-prone PCR technique.

[0042] Error-prone PCR reaction system (50μL):

[0043] Add the reagents to the 0.2mL EP tube in the following order:

[0044]

[0045] PCR reaction conditions:

[0046]

[0047] After the PCR reaction, 2 μL of the amplified product was subjected to agarose gel (0.8%) electrophoresis, the result was observed, and the PCR product at about 870 bp was purified and recovered....

Embodiment 2

[0074] Example 2: Activation and induced expression of mutants

[0075] Pick a single clone from the plate cultured overnight to a 96-deep well plate, fill each empty plate with 200 μL of LB medium containing 50 μg / mL kana antibiotics, cultivate overnight at 37°C, and then pipette 10 μL of the overnight cultured bacterial solution to the plate containing 800 μL 96-deep-well plate of LB medium containing 50 μg / mL kanabioxin, cultured at 37°C for about 2 hours, until OD 600 Add IPTG with a final concentration of 0.5mM between 0.6-0.8, and culture at 16°C for 16-20h. Centrifuge at 5000r / min for 30min to collect the bacteria, resuspend in LysisBuffer (20mM Tirs-HCl 20mM imidazole 500mM NaCl pH=7.4), mix well and add 200μL lysozyme, 300μL PMSF and 0.1% (v / v) TritonX-100, Incubate at 37°C for about 2 hours. Centrifuge at 5000r / min for 30min, draw 100 microliters of supernatant into a new 96-well plate, add 1% (w / v) fructose, react at 60°C for 10min, boil the reaction solution for ...

Embodiment 3

[0076] Embodiment 3: HPLC identifies the generation of D-psicose product

[0077] HPLC detection conditions are:

[0078] Chromatograph: Agilent1260;

[0079] Detector: Evaporative Light Scattering Detector (Alltech Chrom, ELSD6000)

[0080] Injection: Agilent autosampler; injection volume 20 μL;

[0081] Chromatographic column: Prevail Carbohydrate ES column-W (5μm, 4.6×250mm, Agela Technologies, China); column temperature 40°C;

[0082] Mobile phase: 85% acetonitrile; flow rate 1 mL / min.

[0083] The result is as figure 1 As shown, the substrate D-fructose and the product D-psicose are well retained and separated in the column.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a mutant of D-allulose 3-epimerase. The amino acid sequence of the mutant is an amino acid sequence obtained through replacing the 124th asparagine with arginine and replacing the 63rd serine with glycine on the base of the amino acid sequence of the D-allulose 3-epimerase as shown in SEQID NO:1, or is an amino acid sequence obtained by replacing the 105th valine with alanine, replacing 124th asparagine with arginine and replacing the 63rd serine with glycine. The catalytic activity of the mutant disclosed by the invention is notably improved, and is 179% or 223% of thatof a wild type mutant; besides, the temperature stability is also notably improved, and the half-life of the mutant at 60 DEG C is 1.7 times or 3.7 times of that of the wild type mutant. The mutant has important significance in production of the D-allulose under the high-temperature condition.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and enzyme engineering, and specifically relates to a mutant of D-psicose-3-epimerase (DAE) and its application. Background technique [0002] D-allulose 3-epimerase (D-allulose 3-epimerase, referred to as DAE) can catalyze the epimerization of various ketose C3 positions, and is a good catalyst for the production of rare sugars. The substrate produces D-psicose with high added value. [0003] D-psicose is an important member of the rare sugar family and a new type of low-energy sweetener. Due to its high sweetness and low energy, D-psicose is considered to be an ideal sweetener and an effective substitute for sucrose. It can help manufacturers reduce sucrose in formulations for the development of low-calorie food and beverages. At the same time, D-psicose can undergo Maillard reaction, which helps to improve food quality and can perfectly replace sugar. In addition, D-psicose also...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/90C12P19/24C12P19/02
CPCC12N9/90C12P19/24C12P19/02C12Y501/03
Inventor 秦慧民路福平毛淑红李玉朱张亮
Owner TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap