Check patentability & draft patents in minutes with Patsnap Eureka AI!

Attenuated recombinant bacterium, preparation method thereof, application, and tumor targeted medicine

A technology of recombinant engineering bacteria and tumor targeting, which is applied in the field of tumor targeting drugs, attenuated recombinant engineering bacteria and its preparation, can solve the lack of early diagnosis and treatment measures for pancreatic cancer, the survival rate of pancreatic cancer patients is less than 8%, and the Cancer has no significant therapeutic effect and other problems, and achieves good tumor suppression effect, inhibition of pancreatic cancer growth, and high tumor targeting specificity

Inactive Publication Date: 2020-02-04
HUNAN UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is a lack of effective early diagnosis and treatment measures for pancreatic cancer, resulting in the overall 5-year survival rate of pancreatic cancer patients being less than 8%, which poses a serious threat to

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Attenuated recombinant bacterium, preparation method thereof, application, and tumor targeted medicine
  • Attenuated recombinant bacterium, preparation method thereof, application, and tumor targeted medicine
  • Attenuated recombinant bacterium, preparation method thereof, application, and tumor targeted medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] An attenuated Salmonella typhimurium strain (ΔppGpp) of the present invention is synthesized by two synthetases, PSI and PSII, respectively encoded by relA and spotT genes, and inhibits the synthesis of ppGpp by constructing double deletion mutants of the relA and spotT genes.

[0040] Its concrete preparation method is:

[0041] (1) Design two pairs of primers for the relA and spotT gene sequences, each primer contains at least 40 bp complementary to the target gene, and 20 bp complementary to the template plasmid.

[0042] The relA forward primer sequence is:

[0043] 5'-gtggatcgcaagcctgggaatttccagccagcagtcgtgtgagcgcttaggtgtaggctggagctgcttc-3' (SEQ ID NO. 4);

[0044] The relA reverse primer sequence is:

[0045] 5'-gtgcagtcgccgtgcatcaatcacatccggcacctggttcagcttaccgaattccggggatccgtcgacc-3' (SEQ ID NO. 5);

[0046] The sequence of the spotT forward primer is:

[0047] 5'-ttaagcgtcttcggcaggcgtatctcgttgcacgtgacgctcacgagggctgtaggctggagctgcttc-3' (SEQ ID NO. 6);

[0048]...

Embodiment 2

[0067] An attenuated recombinant engineering bacterium (SL.lux / ClyA) carrying a plasmid encoding ClyA, the preparation method of which comprises the following steps:

[0068] (1) Prepare the recombinant plasmid encoding ClyA:

[0069] 1.1. Using human Salmonella typhi (Salmonella typhi) genomic DNA as a template, the ClyA gene fragment was amplified by PCR. The specific primer sequences are as follows:

[0070] ClyA gene (SEQ ID NO.1):

[0071] atgaccggaatatttgcagaacaaactgtagaggtagttaaaagcgcgatcgaaaccgcagatggggcattagatctttataacaaatacctcgaccaggtcatcccctggaagacctttgatgaaaccataaaagagttaagccgttttaaacaggagtactcgcaggaagcttctgttttagttggtgatattaaagttttgcttatggacagccaggacaagtattttgaagcgacacaaactgtttatgaatggtgtggtgtcgtgacgcaattactctcagcgtatattttactatttgatgaatataatgagaaaaaagcatcagcccagaaagacattctcattaggatattagatgatggtgtcaagaaactgaatgaagcgcaaaaatctctcctgacaagttcacaaagtttcaacaacgcttccggaaaactgctggcattagatagccagttaactaatgatttttcggaaaaaagtagttatttccagtcacaggtggatagaattcgtaaggaagcttatgccggtg...

Embodiment 3

[0082] In vitro activity identification of attenuated recombinant engineering bacteria expressing ClyA:

[0083] 1. Cultivation of recombinant engineered bacteria:

[0084] Experimental group: the attenuated recombinant engineered bacteria (SL.lux / ClyA) carrying the plasmid encoding ClyA of Example 2;

[0085] Control group: the attenuated Salmonella typhimurium (SL.lux) that does not carry the plasmid encoding ClyA in Example 1.

[0086] 2. Hemolysis test:

[0087] 2.1. Evenly smear 100 μl of 40% L-arabinose on a fresh blood plate with a diameter of 10 cm, and inoculate the attenuated recombinant engineered bacteria (SL. Plasmids of attenuated Salmonella typhimurium (SL.lux).

[0088] 2.2. Incubate overnight at 37°C to observe the hemolysis of the plate to confirm the expression and activity of ClyA.

[0089] 3. Detection of ClyA expression by Western blot:

[0090]3.1. Take single colonies of SL.lux / ClyA and SL.lux from the plates in step 2.2, and culture them overnight...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an attenuated recombinant bacterium, a preparation method thereof, application, and a tumor targeted medicine. RelA and spoT mutant salmonella typhimurium is adopted as a carrier, and a recombinant plasmid for encoding a ClyA gene is transferred into the relA and spoT mutant salmonella typhimurium so as to obtain the attenuated recombinant bacterium. The preparation methodcomprises the steps of constructing the recombinant bacterium, preparing the relA and spoT mutant salmonella typhimurium, and guiding. According to the attenuated recombinant bacterium, through the plasmid carrying encoding cytolysin, ClyA protein is over-expressed after a bacterium targeting tumor, tumor stroma cells and tumor cells are effectively killed through destroying the completeness of acell membrane, and the attenuated recombinant bacterium can be applied to preparing the tumor targeted medicine.

Description

technical field [0001] The invention relates to the field of medical technology, in particular to an attenuated recombinant engineered bacterium, its preparation method, application and tumor targeting drug. Background technique [0002] Pancreatic cancer (pancreatic cancer) is a highly malignant tumor of the digestive system, and its morbidity and mortality have been on the rise worldwide in recent years. At present, there is a lack of effective early diagnosis and treatment measures for pancreatic cancer, resulting in the overall 5-year survival rate of pancreatic cancer patients being less than 8%, which poses a serious threat to human life and health. According to the data released by the National Cancer Prevention and Control Center of my country in 2018, more than 80,000 people died of pancreatic cancer in my country in 2014, ranking sixth among all cancers, second only to lung cancer, liver cancer, gastric cancer, esophageal cancer and colorectal cancer. cancer. Ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74A61K48/00A61K38/16A61K31/7004A61P35/00C12R1/42
CPCA61K31/7004A61K38/164A61K48/0025A61K48/0058A61P35/00C07K14/255C12N9/1235C12N15/74C12Y207/06005A61K2300/00
Inventor 郑金海谭文芝郭艳霞
Owner HUNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More