Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

EBV (Epstein-Barr virus) detection kit

A technology of virus detection and kit, which is applied in the field of molecular biotechnology and genetic detection, can solve the problem of not being able to display the specific number of viruses in the active phase, and achieve the effect of fast and simple interpretation of results, low requirements for facility conditions, and avoiding cross-contamination

Active Publication Date: 2020-02-25
广州市宝创生物技术有限公司
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Serum detection of antibodies can reflect the development trend of the disease to a certain extent, but it cannot show the specific amount of active virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EBV (Epstein-Barr virus) detection kit
  • EBV (Epstein-Barr virus) detection kit
  • EBV (Epstein-Barr virus) detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The EBV nucleic acid detection kit used in this example uses gold nano probes without LNA modification and gold nano probes containing LNA modification to verify the superiority of hybridization efficiency of LNA modified gold nano probes.

[0051] In this embodiment, the EBV nucleic acid detection kit is composed of a pair of primers, an upstream probe, a downstream probe, a hairpin probe, a pair of nano gold probes, a reaction solution and an enzyme solution. The primers and probes The sequence is shown below.

[0052] Upstream primer: GCTAAGCCCAACACTCCACCAC (SEQ ID NO: 1);

[0053] Downstream primer: CCTTCTTAGGAGCTGTCCGAGGG (SEQ ID NO: 2);

[0054] Upstream probe: ACCCAGGCACACACTACACT (SEQ ID NO: 3);

[0055] Downstream probe: CGCGCCGAGGACACCCACCCGTC (SEQ ID NO: 4);

[0056] Hairpin probe: TTG GTC TGG TGC TAC ACT CGT CTC GGT TTT CCG AGA CGA GTC CTCGGC GCG ATC GTG ATG AAC CAT (SEQ ID NO: 5);

[0057] Nano gold probe 1: Au-TTTTTT-ATG GTT CaT CAC GAT (SEQ ID NO: 6);

[0058] Nano g...

Embodiment 2

[0061] Example 2 Optimization of EBV nucleic acid detection method

[0062] In this example, the EBV nucleic acid detection kit is used to detect the EBV plasmid template and the negative reference respectively, and different data processing methods are verified to achieve better discrimination of the detection results, and at the same time to meet the user's requirements in a better way. Get used to and enhance the user experience of the test kit.

[0063] The reagent kit has a volume of 20μL, and its components are: 10mM Tris buffer (pH 8.5), 1μM primers (upstream primer, downstream primer), 1μM probe (upstream probe, downstream probe, hairpin probe) ), 0.05μM gold nanoprobe (nano gold probe 1, nano gold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease AfuFEN. Add 10 to the system sequentially 5 And 0 copies of the nucleic acid to be tested (the template sequence is shown in SEQ ID NO: 8). The reaction system is composed of a reaction program: 95°C, 20s; 99°C, 2s,...

Embodiment 3

[0067] Example 3 Sensitivity of EBV nucleic acid detection reagent

[0068] In this example, the EBV nucleic acid detection kit was used to detect EBV plasmid templates of different concentrations to verify the feasibility of the method of the present invention.

[0069] The reagent kit has a volume of 20μL, and its components are: 10mM Tris buffer (pH 8.5), 1μM primers (upstream primer, downstream primer), 1μM probe (upstream probe, downstream probe, hairpin probe) ), 0.05μM gold nanoprobe (nano gold probe 1, nano gold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease AfuFEN. Add 10 to the system sequentially 5 , 10 4 , 10 3 , 10 2 , 10, 1 and 0 copies of the nucleic acid to be tested (the template sequence is shown in SEQ ID NO: 8). The reaction system is composed of a reaction program: 95°C, 20s; 99°C, 2s, 70°C, 30s, 35 cycles; 63°C, 10min; 55°C, 5min. After the reaction, the result is shown in figure 2 in. figure 2 The results show that the kit of the present i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biotechnology and gene detection, in particular to an EBV (Epstein-Barr virus) detection kit, comprising: a), a primer pair; b), an upstream probe, downstream probes and a hairpin probe; and c), two nanogold probes. The above-mentioned primers and probes are suitable for carrying out high-sensitivity high-resolution low-cost detection of EBV under closed tube condition, so that cross contaminations to amplification products can be effectively avoided.

Description

Technical field [0001] The present invention relates to the fields of molecular biotechnology and gene detection, in particular to an EBV virus detection kit. Background technique [0002] Epstein-Barr virus (EBV) virus is a lymphotropic double-stranded DNA virus, belonging to the herpesvirus γ subfamily. Since EBV was discovered in 1964, more and more diseases have been confirmed by EBV infection. In normal people EBV infection rate in medium> 90%, and carry for life. At present, the detection technology for EBV is becoming more and more mature. The commonly used detection methods mainly include culture, immunoassay, EBV DNA load detection, etc. People with EBV infection usually have elevated peripheral blood lymphocytes and associated abnormal lymphocytes and elevated transaminases, but this It is of little help in the diagnosis of EBV infection. Detection of antibodies by serum can reflect the development trend of the disease to a certain extent, but it cannot show the sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6816
CPCC12Q1/6816C12Q2563/137C12Q2563/155
Inventor 王建平王志新
Owner 广州市宝创生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com