Antibody for specifically detecting BRAF gene mutation and application of antibody in preparation of cancer detection kit

A kind of specific and monoclonal antibody technology, applied to specific peptides, measuring devices, instruments, etc., can solve the problems of not providing antibody structure form, not being able to obtain monoclonal antibodies, and not being able to detect mutant proteins at the same time, so as to achieve good specificity and accuracy sexual effect

Active Publication Date: 2020-06-16
方达医药技术(上海)有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, immunohistochemistry can specifically detect the V600E mutant protein of the BRAF gene, but cannot simultaneously detect other types of mutant proteins su

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody for specifically detecting BRAF gene mutation and application of antibody in preparation of cancer detection kit
  • Antibody for specifically detecting BRAF gene mutation and application of antibody in preparation of cancer detection kit
  • Antibody for specifically detecting BRAF gene mutation and application of antibody in preparation of cancer detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Preparation of immunogen

[0024] According to the requirements for the preparation of V600-specific monoclonal antibodies at the target site, and according to the structural characteristics of the BRAF protein, through analysis, the optimal immune peptide sites were selected, which are BRAF V600E protein: gdfglateksrw and BRAF V600 protein: gdfglatvksrw; The fold repeat unit is used as an immunogen to enhance subsequent immune activity. According to the expression characteristics of E. coli, the corresponding coding sequences were obtained:

[0025] BRAF V600E protein coding sequence:

[0026] 1 GGTGACTTTG GTCTGGCGAC CGAGAAAAGC CGTTGGGGTG ATTTTGGCCT GGCAACCGAGAAATCTCGTT

[0027] 71 GGGGCGACTT CGGCCTGGCT ACCGAAAAAT CCCGTTGGGG CGACTTTGGC CTGGCAACGGAAAAATCCCG

[0028] 141 CTGG

[0029] BRAF V600 protein coding sequence:

[0030] 1 GGTGACTTTG GTCTGGCAAC CGTAAAATCT CGTTGGGGCG ACTTCGGTCT GGCGACGGTTAAATCCCGTT

[0031] 71 GGGGTGATTT CGGCCTGGCG ACTGTCAAAA GCCGCTGGGG TGACTTCGGC C...

Embodiment 2

[0035] Example 2 Preparation of monoclonal antibodies

[0036] For the first time, complete Freund’s adjuvant and an equal volume of antigen (polypeptide protein of Example 1, 100mg / mL) were emulsified and injected subcutaneously or inguinal into mice, 30ug / mouse; afterwards, incomplete Freund’s adjuvant was used every 14 days After emulsification with an equal volume of antigen, the mice were alternately immunized through the abdominal cavity and subcutaneously, 30ug / mouse; after 4 immunizations, blood was collected from the tail vein, and the anti-antibody titer in the serum of the immunized mice was determined by indirect ELISA. There were 12 mice in total.

[0037] The titer of the anti-BRAF V600E protein antibody in the immune serum was determined by collecting blood from the tail vein. The steps are briefly described as follows: use BRAF V600E protein 1ug / ml, 100ul / well to coat the polystyrene ELISA plate, 4℃ for 16 h; 0.25% casein blocking solution 300ul / well for 4℃ for 24h....

Embodiment 3

[0043] Example 3 Preparation of monoclonal antibodies

[0044] (1) Preparation of monoclonal antibody ascites The 600E-7 hybridoma cell line was cultured to the logarithmic growth phase, the cells were collected by centrifugation, and the cells were washed twice with pre-cooled PBS, and finally resuspended in an appropriate amount of pre-cooled 1640 medium. Press 3X10 6 -6X10 6 Individual cells / mouse were injected intraperitoneally (mouse was intraperitoneally injected with 0.5 ml of Freund’s incomplete adjuvant 1 week ago), collected ascites after about 2 weeks, collected ascites serum after centrifugation, and added immediately to a final concentration of 0.1 % Sodium azide, stored at 4℃ for later use.

[0045] (2) Monoclonal antibody purification The ascites prepared by hybridoma cells was purified by the caprylic acid-ammonium sulfate precipitation method. The operation method is briefly described as follows: Add 20ml of sodium acetate buffer (0.06M, pH 4.4) to 10ml of monoclo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an antibody for specifically detecting BRAF gene mutation and application of the antibody in cancer detection. According to the invention, the 600E polypeptide is used for preparing the monoclonal antibody; v600 is used as a reverse screening protein to finally obtain a monoclonal antibody specific to 600E mutant polypeptide, and after the monoclonal antibody is coupled through magnetic beads, the 600E mutant cells can be specifically detected, so that the specificity and accuracy are relatively good, and the application prospect is relatively good.

Description

Technical field [0001] The present invention relates to the field of antibodies, and more specifically to antibodies that specifically detect BRAF gene mutations and their use in preparing cancer detection kits. Background technique [0002] The RAF gene is one of the most important proto-oncogenes widely found in mammals, and has three subtypes: ARAF, BRAF, and CRAF. Among them, BRAF has the strongest kinase activity. It consists of 18 exons and encodes a protein of about 94kDa; due to missense mutations of thymine (T) and adenine (A) in a single base of exon 15 The valine at codon 600 of the translated protein is replaced by glutamic acid, resulting in a protein sequence change, that is, the V600E mutation. In addition to the V600E mutation, many unique and rare non-hot spot mutations were detected in exon 15 of the BRAF gene, such as T599I, T599dup, and K601E. The BRAF gene V600E mutation results in abnormal conduction of the KRAS / BRAF / MAPK pathway, causing excessive cell pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K16/32G01N33/577G01N33/574G01N33/543
CPCC07K16/32C07K2317/35C07K2317/92G01N33/54326G01N33/56966G01N33/57488G01N33/577
Inventor 刘欢侯冬雪
Owner 方达医药技术(上海)有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap