Carbohydrate binding domain specifically binding to carrageenan and its preparation and application
A technology of carbohydrates and binding domains, which is applied in the field of biotechnology and biochemical detection, can solve the problems of no carrageenan, etc., and achieve the effects of low cost, high accuracy, and simple preparation procedures
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1: Cloning, expression and acquisition of CBM CBP_Wa specifically binding to carrageenan in Escherichia coli
[0051] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers (5'-GTGCCGCGCGGCAGCCATATGAATTTAAAAGCTTCCAATAACA; 5'-GTGGTGGTGGTGGTGCTCGAGTTAAATGTCAAACTTTAAGGCTG) were designed according to the desired target gene. PCR was carried out using the whole genome as a template. The PCR reaction conditions were 95°C for 3 min, 95°C for 30 s, 52°C for 30 s, 72°C for 40 s, 25 cycles, and finally 72°C for 5 min to obtain the CBP_Wa gene fragment. NdeI and XhoI double-digest the target gene and pET28a(+) expression vector, and connect to form a recombinant plasmid. Heat shock treatment at 42°C transformed the recombinant plasmid into BL21(DE3) competent cells to form a recombinant strain. The expression was induced by isopropyl-β-D-thiogalactoside, t...
Embodiment 2
[0052] Example 2: Cloning, expression and acquisition of CBMCBP_Wa specifically binding to carrageenan in Pichia pastoris
[0053] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers (5'-AGCTTACGTAGAATTCAATTTAAAAGCTTCCAATAACAACAAATTTATTACTGTAGTAAGC; 5'-AATTAATTCGCGGCCGCTTAAATGTCAAACTTTAAGGCTGCATTTTTATTTATTTCCAT template) were designed according to the target gene, and the whole genome was used as the template in Example 1 Perform PCR to obtain the CBP_Wa gene fragment. Use EcoRI and NotI to double digest the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after SacI digestion, transform into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH 8.0N,N-dihydroxy Re-suspend the bacteria in ethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, and culture it upside ...
Embodiment 3
[0054] Embodiment 3: the CBM CBP_Wa that specifically binds to carrageenan is cloned and expressed and obtained in Bacillus subtilis
[0055] Culture Wenyingzhuangia fucanilytica OF219 in 2216E medium until the end of the logarithm and extract the whole genome DNA, design the upstream and downstream primers according to the target gene (5'-CGTAGGATCCTCTAGAAATTTAAAAGCTTCCAATAACAACAAATTTATTTACTGTAGTAAGC; 5'-TAGGCGGGCTGCCCCGGGGttaAATGTCAAACTTTAAAGGCTGCATTTTTATTTATTT take the whole genome as the template in Example 1) PCR was carried out under the conditions to obtain the CBP_Wa gene fragment. XbaI and SmaI double-digested target gene and pHT43 plasmid, ligated to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90min, and spread on LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultured for 12 hours, inoculated into the basic fermentation medium at 37°C at 3% inocul...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com