Novel algin specific binding protein and preparation method and application thereof
A technology for binding protein and algin, which is applied in the fields of biotechnology and biochemical detection, and can solve the problems that there is no effective way to efficiently obtain the specific binding protein of algin, rare algin, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: Cloning, expression and acquisition of alginate-specific binding protein AusG_Wf in Escherichia coli
[0050] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and the whole genome DNA was extracted, two pairs of upstream and downstream primers were designed according to the desired target gene (the first pair: 5'AAGTTGGTGGCCGCTATCAC; 5'GGCAAGTAGCATTCACAGATAG), (the second pair: 5'GACACGACACCATATGGAAGATTTACCAGAGGCTGG; 5'GACACCTCGAGTTATTCTGGTTTAGCAATAATAGTCAC). Two rounds of PCR were performed using the whole genome as a template. The PCR reaction conditions were 95°C for 3 min, 95°C for 30 s, 52°C for 30 s, 72°C for 60 s, 25 cycles, and finally 72°C for 5 min to obtain the AusG_Wf gene fragment. NdeI and XhoI double-digest the target gene and pET28a(+) expression vector, and connect to form a recombinant plasmid. Heat shock treatment at 42°C transformed the recombinant plasmid into BL21(DE3) competent cells t...
Embodiment 2
[0051] Example 2: Cloning, expression and acquisition of alginate-specific binding protein AusG_Wf in Pichia pastoris
[0052] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithmic period and extract the whole genome DNA, design the upstream and downstream primers (5'- AGCTTACGTAGAATTCGAAGATTTACCAGAGGCTGGTTCTAAACC; 5'- AATTAATTCGCGGCCGCTTCTGGTTTAGCAATAATAGTCACATCATCTACTCT) according to the target gene, and use the whole genome as a template to perform PCR under the conditions in Example 1 to obtain the specific binding of alginate Protein AusG_Wf gene fragment. Use EcoRI and NotI to double digest the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after Sac I digestion, transform into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH 8.0N,N-2 Re-suspend the bacteria in hydroxyethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, ...
Embodiment 3
[0053] Embodiment 3: Cloning expression and acquisition of algin-specific binding protein AusG_Wf in Bacillus subtilis
[0054] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-CGTAGGATCCTCTAGAGAAGATTTACCAGAGGCTGGTTCTAAACC; 5'-TAGGCGGGCTGCCCCGGGTTCTGGTTTAGCAATAATAGTCACATCATCTACTCTTG) according to the target gene, and use the whole genome as a template to perform PCR according to the conditions as in Example 1 to obtain algin-specific Binding protein AusG_Wf gene fragment. XbaI and SmaI double-digested target gene and pHT43 plasmid, ligated to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90min, and spread on LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultured for 12 hours, inoculated into the basic fermentation medium at 37°C at ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


