A kind of sea cucumber fucoidan-specific binding protein and its preparation and application
A fucoidan and protein-binding technology, which is applied in the fields of biotechnology and biochemical detection, can solve the problem that the specific qualitative, semi-quantitative and in-situ visualization of sea cucumber fucoidan is difficult to achieve, and the specificity of sea cucumber fucoidan is difficult to achieve. The lack of binding protein and other problems can achieve the effect of simple operation, low preparation cost and clear sequence.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: Cloning, expression and acquisition of sea cucumber fucoidan specific binding protein FBP_Wf in Escherichia coli
[0050] Wenyingzhuangia fucanilytica CZ1127T was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. Two pairs of upstream and downstream primers (5' AGGAGATATACCATGGGCTCAGTAACGGTGGATTTAGAAAATAAAACT) and (5' GGTGGTGGTGCTCGAGATTTACAATATTTTTAAAAACTTGAACCTCTGCTAAAGCT) were designed according to the desired target gene. Take the whole genome as a template to carry out two rounds of PCR, the PCR reaction conditions are 95 ° C for 3min, 95 ° C for 30s, 52 ° C for 30s, 72 ° C for 60s, 25 cycles, last 72 ° C for 5min, obtained the FBP_Wf gene fragment . The target gene was digested with NcoI and XhoI, and the pET28a(+) expression vector was connected to form a recombinant plasmid. The recombinant plasmid was transformed into BL21 (DE3) competent cells by heat shock treatment at 42°C to form a recombinant st...
Embodiment 2
[0051] Example 2: Cloning, expression and acquisition of sea cucumber fucoidan-specific binding protein FBP_Wf in Pichia pastoris
[0052] Wenyingzhuangia fucanilytica CZ1127T was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'- AGCTTACGTAGAATTCTCAGTAACGGTGGATTTAGAAAATAAAACTTCTTCTATCA; 5'- AATTAATTCGCGGCCGCATTTACAATATTTTTAAAAACTTGAACCTCTGCTAAAGCT) were designed according to the target gene. PCR was performed to obtain the FBP_Wf gene fragment of the sea cucumber fucoidan specific binding protein. The target gene was digested with EcoRI and NotI and the pPIC9k plasmid was connected to form a recombinant plasmid. After digestion with Sac I, it was transformed into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, 10mM pH 8.0 N,N-di Hydroxyethyl glycine resuspended the bacteria; spread the bacteria solution onto a YPD plate containing ampicillin, invert...
Embodiment 3
[0053] Example 3: Cloning, expression and acquisition of sea cucumber fucoidan specific binding protein FBP_Wf in Bacillus subtilis
[0054] Wenyingzhuangia fucanilytica CZ1127T was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-CGTAGGATCCTCTAGATCAGTAACGGTGGATTTAGAAAATAAAACTTCTTCT; 5'- TAGGCGGGCTGCCCCGGGATTTACAATATTTTTAAAAACTTGAACCTCTGCTAAAGCT) were designed according to the target gene. PCR conditions were carried out to obtain the FBP_Wf gene fragment of sea cucumber fucoidan specific binding protein. XbaI and SmaI double digestion of the target gene and pHT43 plasmid, connected to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, after culturing 90min at 37 ° C, coated on the LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultivated for 12h, inoculated into the basal fermentation medium by ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


