Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of sea cucumber fucoidan-specific binding protein and its preparation and application

A fucoidan and protein-binding technology, which is applied in the fields of biotechnology and biochemical detection, can solve the problem that the specific qualitative, semi-quantitative and in-situ visualization of sea cucumber fucoidan is difficult to achieve, and the specificity of sea cucumber fucoidan is difficult to achieve. The lack of binding protein and other problems can achieve the effect of simple operation, low preparation cost and clear sequence.

Active Publication Date: 2022-06-28
OCEAN UNIV OF CHINA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is the lack of specific binding proteins for sea cucumber fucoidan at present, which makes it difficult to realize specific qualitative, semi-quantitative, and in-situ visualization of sea cucumber fucoidan, which is not conducive to sea cucumber fucoidan. in-depth research and development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of sea cucumber fucoidan-specific binding protein and its preparation and application
  • A kind of sea cucumber fucoidan-specific binding protein and its preparation and application
  • A kind of sea cucumber fucoidan-specific binding protein and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Cloning, expression and acquisition of sea cucumber fucoidan specific binding protein FBP_Wf in Escherichia coli

[0050] Wenyingzhuangia fucanilytica CZ1127T was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. Two pairs of upstream and downstream primers (5' AGGAGATATACCATGGGCTCAGTAACGGTGGATTTAGAAAATAAAACT) and (5' GGTGGTGGTGCTCGAGATTTACAATATTTTTAAAAACTTGAACCTCTGCTAAAGCT) were designed according to the desired target gene. Take the whole genome as a template to carry out two rounds of PCR, the PCR reaction conditions are 95 ° C for 3min, 95 ° C for 30s, 52 ° C for 30s, 72 ° C for 60s, 25 cycles, last 72 ° C for 5min, obtained the FBP_Wf gene fragment . The target gene was digested with NcoI and XhoI, and the pET28a(+) expression vector was connected to form a recombinant plasmid. The recombinant plasmid was transformed into BL21 (DE3) competent cells by heat shock treatment at 42°C to form a recombinant st...

Embodiment 2

[0051] Example 2: Cloning, expression and acquisition of sea cucumber fucoidan-specific binding protein FBP_Wf in Pichia pastoris

[0052] Wenyingzhuangia fucanilytica CZ1127T was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'- AGCTTACGTAGAATTCTCAGTAACGGTGGATTTAGAAAATAAAACTTCTTCTATCA; 5'- AATTAATTCGCGGCCGCATTTACAATATTTTTAAAAACTTGAACCTCTGCTAAAGCT) were designed according to the target gene. PCR was performed to obtain the FBP_Wf gene fragment of the sea cucumber fucoidan specific binding protein. The target gene was digested with EcoRI and NotI and the pPIC9k plasmid was connected to form a recombinant plasmid. After digestion with Sac I, it was transformed into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, 10mM pH 8.0 N,N-di Hydroxyethyl glycine resuspended the bacteria; spread the bacteria solution onto a YPD plate containing ampicillin, invert...

Embodiment 3

[0053] Example 3: Cloning, expression and acquisition of sea cucumber fucoidan specific binding protein FBP_Wf in Bacillus subtilis

[0054] Wenyingzhuangia fucanilytica CZ1127T was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-CGTAGGATCCTCTAGATCAGTAACGGTGGATTTAGAAAATAAAACTTCTTCT; 5'- TAGGCGGGCTGCCCCGGGATTTACAATATTTTTAAAAACTTGAACCTCTGCTAAAGCT) were designed according to the target gene. PCR conditions were carried out to obtain the FBP_Wf gene fragment of sea cucumber fucoidan specific binding protein. XbaI and SmaI double digestion of the target gene and pHT43 plasmid, connected to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, after culturing 90min at 37 ° C, coated on the LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultivated for 12h, inoculated into the basal fermentation medium by ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a sea cucumber fucoidan-specific binding protein and its preparation and application. Sea cucumber fucoidan-specific binding protein FBP_Wf has specific binding ability to sea cucumber fucoidan, and its amino acid sequence is SEQ ID NO.1. The preparation procedure of FBP_Wf in the present invention is simple, fast, low in cost, and can be prepared in large quantities, which solves the current problem of lack of sea cucumber fucoidan-specific binding proteins. In addition, the present invention also provides methods and application examples based on FBP_Wf in qualitative, semi-quantitative, and visual observation of sea cucumber fucoidan, proving that FBP_Wf is a good tool for studying sea cucumber fucoidan, and has development and application prospects.

Description

technical field [0001] The invention relates to the technical field of biotechnology and biochemical detection, in particular to a sea cucumber fucoidan specific binding protein and its preparation and application. Background technique [0002] Sea cucumber is a traditional nourishing marine food in my country, which has been proven to have rich nutritional functions. Fucoidan, also known as fucoidan sulfate, fucoidan, and fucoidan, is an important marine polysaccharide, mainly composed of L-fucose and sulfate groups. Sea cucumber fucoidan accounts for about 5-10% of the dry weight of sea cucumber body wall, and is one of the main polysaccharide components and nutritional efficacy components in sea cucumber. A large number of studies have confirmed that fucoidan has a series of regulatory functions such as improving immunity, anti-oxidation, protecting digestive tract mucosa, and relieving renal failure. [0003] Carbohydrate-specific binding proteins are a class of protei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/65G01N33/53
CPCC07K14/195C12N15/65G01N33/5308G01N2333/195
Inventor 常耀光梅轩玮薛长湖申晶晶刘艳艳陈广宁王玉明唐庆娟
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com