Unlock instant, AI-driven research and patent intelligence for your innovation.

A novel alginate-specific binding protein and its preparation and application

A technology for binding proteins and alginate, which is applied in the field of biotechnology and biochemical detection, can solve the problems that there is no effective way to efficiently obtain alginate-specific binding proteins, rare alginate, etc., and achieve low cost, high accuracy, and clear sequence Effect

Active Publication Date: 2022-02-01
OCEAN UNIV OF CHINA
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is that the research on algin-specific binding protein is rare at present, and there is no effective way to efficiently obtain algin-specific binding protein, which is not conducive to the in-depth research and development of algin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A novel alginate-specific binding protein and its preparation and application
  • A novel alginate-specific binding protein and its preparation and application
  • A novel alginate-specific binding protein and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Cloning, expression and acquisition of alginate-specific binding protein AusG_Wf in Escherichia coli

[0050] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and the whole genome DNA was extracted, two pairs of upstream and downstream primers were designed according to the desired target gene (the first pair: 5'AAGTTGGTGGCCGCTATCAC; 5'GGCAAGTAGCATTCACAGATAG), (the second pair: 5'GACACGACACCATATGGAAGATTTACCAGAGGCTGG; 5'GACACCTCGAGTTATTCTGGTTTAGCAATAATAGTCAC). Two rounds of PCR were performed using the whole genome as a template. The PCR reaction conditions were 95°C for 3 min, 95°C for 30 s, 52°C for 30 s, 72°C for 60 s, 25 cycles, and finally 72°C for 5 min to obtain the AusG_Wf gene fragment. NdeI and XhoI double-digest the target gene and pET28a(+) expression vector, and connect to form a recombinant plasmid. Heat shock treatment at 42°C transformed the recombinant plasmid into BL21(DE3) competent cells t...

Embodiment 2

[0051] Example 2: Cloning, expression and acquisition of alginate-specific binding protein AusG_Wf in Pichia pastoris

[0052] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithmic period and extract the whole genome DNA, design the upstream and downstream primers (5'- AGCTTACGTAGAATTCGAAGATTTACCAGAGGCTGGTTCTAAACC; 5'- AATTAATTCGCGGCCGCTTCTGGTTTAGCAATAATAGTCACATCATCTACTCT) according to the target gene, and use the whole genome as a template to perform PCR under the conditions in Example 1 to obtain the specific binding of alginate Protein AusG_Wf gene fragment. Use EcoRI and NotI to double digest the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after Sac I digestion, transform into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH 8.0N,N-2 Re-suspend the bacteria in hydroxyethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, ...

Embodiment 3

[0053] Embodiment 3: Cloning expression and acquisition of algin-specific binding protein AusG_Wf in Bacillus subtilis

[0054] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-CGTAGGATCCTCTAGAGAAGATTTACCAGAGGCTGGTTCTAAACC; 5'-TAGGCGGGCTGCCCCGGGTTCTGGTTTAGCAATAATAGTCACATCATCTACTCTTG) according to the target gene, and use the whole genome as a template to perform PCR according to the conditions as in Example 1 to obtain algin-specific Binding protein AusG_Wf gene fragment. XbaI and SmaI double-digested target gene and pHT43 plasmid, ligated to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90min, and spread on LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultured for 12 hours, inoculated into the basic fermentation medium at 37°C at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a novel alginate-specific binding protein and its preparation and application. AusG_Wf has specific binding ability to alginate, and its amino acid sequence is SEQ ID NO.1. The preparation procedure of AusG_Wf in the present invention is simple, rapid, low-cost, and can be prepared in large quantities, which solves the problem that the alginate-specific binding protein cannot be efficiently obtained before. In addition, the present invention also provides methods and application examples based on AusG_Wf in the qualitative, semi-quantitative and visual observation of alginate. AusG_Wf is an ideal tool for studying alginate and has considerable development and application prospects.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a novel alginate-specific binding protein and its preparation and application. Background technique [0002] Alginate is a kind of natural anionic polysaccharide existing in the cell walls of kelp, sargassum, macroalgae, etc. into linear polymers. Alginate is an important marine polysaccharide, because of its good gelling, emulsifying, thickening and other physical and chemical properties, it has been widely used in food, chemical, pharmaceutical and other fields. It has been proved that alginate has a series of physiological regulation functions such as promoting gastrointestinal motility, neuroprotection, lowering blood fat, anticoagulant, anti-virus, etc. It also has great potential in the development of functional foods. [0003] Carbohydrate-specific binding proteins are a class of proteins that can specifically recognize and bind carbohydr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/195C12N15/31C07K19/00G01N21/64
CPCC07K14/195G01N21/6486C07K2319/00
Inventor 常耀光梅轩玮申晶晶薛长湖李嘉靖陈广宁李兆杰唐庆娟
Owner OCEAN UNIV OF CHINA