Unlock instant, AI-driven research and patent intelligence for your innovation.

Carbohydrate binding domain specifically bound with carrageenan and preparation and application thereof

A carbohydrate and binding domain technology, applied in the field of biotechnology and biochemical detection, can solve problems such as unseen carrageenan, and achieve the effects of low cost, clear sequence, and clear gene sequence

Active Publication Date: 2020-08-07
OCEAN UNIV OF CHINA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is that there is no research on CBM specifically binding carrageenan at present, which is not conducive to the in-depth research and development of carrageenan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbohydrate binding domain specifically bound with carrageenan and preparation and application thereof
  • Carbohydrate binding domain specifically bound with carrageenan and preparation and application thereof
  • Carbohydrate binding domain specifically bound with carrageenan and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Cloning, expression and acquisition of CBM CBP_Wa specifically binding to carrageenan in Escherichia coli

[0051] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers were designed according to the desired target gene (5'- GTGCCGCGCGGCAGCCATATGAATTTAAAAGCTTCCAATAACA; 5'- GTGGTGGTGGTGGTGCTCGAGTTAAATGTCAAACTTTAAGGCTG). PCR was performed using the whole genome as a template. The PCR reaction conditions were 95°C for 3 min, 95°C for 30 s, 52°C for 30 s, 72°C for 40 s, 25 cycles, and finally 72°C for 5 min to obtain the CBP_Wa gene fragment. NdeI and XhoI double-digest the target gene and pET28a(+) expression vector, and connect to form a recombinant plasmid. Heat shock treatment at 42°C transformed the recombinant plasmid into BL21(DE3) competent cells to form a recombinant strain. The expression was induced by isopropyl-β-D-thiogalactoside, t...

Embodiment 2

[0052] Example 2: Cloning, expression and acquisition of CBM CBP_Wa specifically binding to carrageenan in Pichia pastoris

[0053] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers were designed according to the target gene (5'- AGCTTACGTAGAATTCAATTTAAAAGCTTCCAATAACAACAAATTTATTTACTGTAGTAAGC; 5'- AATTAATTCGCGGCCGCTTAAATGTCAAACTTTAAGGCTGCATTTTTATTTATTTCCAT template), such as the whole genome in the example. PCR was carried out under the conditions to obtain the CBP_Wa gene fragment. Use EcoRI and NotI to double digest the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after Sac I digestion, transform into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH 8.0N,N-2 Re-suspend the bacteria in hydroxyethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, and cul...

Embodiment 3

[0054] Embodiment 3: the CBM CBP_Wa that specifically binds to carrageenan is cloned and expressed and obtained in Bacillus subtilis

[0055] Culture Wenyingzhuangiafucanilytica OF219 in 2216E medium until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers according to the target gene (5'- CGTAGGATCCTCTAGAAATTTAAAAGCTTCCAATAACAACAAATTTATTTACTGTAGTAAG C; 5'- TAGGCGGGCTGCCCCGGGttaAATGTCAAACTTTAAGGCTGCATTTTTATTATTTCCATTAG C as the template in Example 1) PCR was carried out under the conditions to obtain the CBP_Wa gene fragment. XbaI and SmaI double-digested the target gene and pHT43 plasmid, connected to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90min, and spread on LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultured for 12 hours, inoculated into the basic fermentation medium at 37°C with a 3% inoculum size,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biotechnology and biochemical detection, in particular to a carbohydrate binding domain specifically bound with carrageenan and a preparation method andapplication of the carbohydrate binding domain. The carbohydrate binding domain specifically bound with carrageenan is named as CBP_Wa, and the amino acid sequence of the carbohydrate binding domainis shown in the formula of SEQ ID NO. 1. The CBP_Wa has a specific binding capacity to carrageenan. The carbohydrate binding domain solves the problem of lack of CBM specifically bound to carrageenanat present. In addition, the invention further provides a method and an application example based on CBP_Wa in carrageenan qualitative, semi-quantitative and visual observation, and the good application potential of CBP_Wa in carrageenan research is shown. The CBP_Wa is a novel tool for researching carrageenan and has practical significance.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a carbohydrate binding domain specifically binding to carrageenan and its preparation and application. Background technique [0002] Carrageenan is a class of sulfated polysaccharides present in red algae such as carrageen and Eucheuma. It is composed of repeating disaccharide units 1,3-O-β-D-galactopyranose and 1,4-O- 3,6-inside ether-α-D-galactopyranose residues alternately composed of linear chain polymers. The three most widely used carrageenans are κ-, ι- and λ-carrageenan. Carrageenan is widely used in food, chemical, pharmaceutical and other fields because of its good gelling, elasticity, transparency and other physical and chemical properties. It has been proved that carrageenan has a series of physiological functions such as anti-virus, anti-coagulation, anti-oxidation, and protection of gastric mucosa. [0003] Carbohydrate binding do...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/38C12N15/56G01N33/577G01N33/573
CPCC12N9/2468C07K14/43595G01N33/577G01N33/573C07K2319/00G01N2333/938
Inventor 常耀光梅轩玮申晶晶薛长湖张玉莹曹斯琦王玉明薛勇
Owner OCEAN UNIV OF CHINA