Gene GhD14 capable of regulating and controlling development of plant stems and lateral branches and application of gene GhD14
A plant development, pbi121-ghd14 technology, applied in the field of plant genetic engineering, can solve the problems of increased plant branch number, flowering delay, branch and leaf senescence, etc., to reduce the number of stem branches, reduce the number of branches, increase The effect of plant height
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Expression patterns of GhD14 gene at different stages of cotton fiber development
[0035]1. Extract the RNA of 0DPA, 3DPA, 5DPA, 10DPA, 15DPA, 20DPA and other tissues of Xuzhou Cotton 142 in different stages of root, stem, leaf and fiber development, reverse transcribe into the first strand cDNA, and design primers according to the dominant gene sequence , GhD14-QRT-F: CCTTGTGACGGTTCCTTGCCA, GhD14-QRT-R: GAAGCACCGGGATGACGATATC, Q-PCR amplification was performed.
[0036] 2. The procedure used to complete the above experiment was pre-denaturation at 95°C for 15s; denaturation at 95°C for 5s, refolding at 60°C for 34s, extension at 72°C for 40s (data receiving); a total of 40 cycles.
[0037] 3. The internal reference gene used to complete the above test is GhUBQ7, and the primer sequence is GhUBQ7-F: GGCATTCACCTGACCAACAA, GhUBQ7-R: CCGCATTAGGGCACTCTTTTC
[0038] 4. For each of the above reactions, 3 biological repeats and 3 technical repeats were set up, and...
Embodiment 2
[0041] Example 2: Obtaining and Phenotypic Analysis of GhD14 Transgenic Arabidopsis Plants
[0042] 1. Construction of recombinant plasmid pCAMBIA2300-GhD14pro-GUS vector and acquisition of plants
[0043] 1. Use primers to amplify to obtain a sequence of about 1893 bp as shown in SEQ ID No.2. The primer sequences are listed in the table below. Primers were designed using the cotton genome (https: / / cottonfgd.org / ) sequence as a reference, and the full-length GhD14 gene was obtained by PCR amplification. The DNA of cotton seedling tissue was used as a template to amplify the full length of the GhD14 gene promoter with carrier adapter primers, and the underlined primers in the following table are the sequences of the target genes.
[0044]
[0045] 2. The promoter was linked to the upstream of the GUS coding sequence by homologous recombination to obtain the recombinant plasmid pCAMBIA2300-GhD14pro-GUS.
[0046] 3. The above-mentioned recombinant plasmid was introduced int...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


