Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene GhD14 capable of regulating and controlling development of plant stems and lateral branches and application of gene GhD14

A plant development, pbi121-ghd14 technology, applied in the field of plant genetic engineering, can solve the problems of increased plant branch number, flowering delay, branch and leaf senescence, etc., to reduce the number of stem branches, reduce the number of branches, increase The effect of plant height

Pending Publication Date: 2021-02-02
SHAANXI NORMAL UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows for better control over how plants grow by transferring certain genes from one type of organism called Arabis or another type of animal called Thai back onto an indigenous species like rice without affecting its growth ability.

Problems solved by technology

This patented describes how certain types of chemical compounds called splaylins act like natural polysaccharides during photosynthesis processes. These molecules help control cell division rates and promote differentiation between cells without affecting other important aspects such as organ development.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene GhD14 capable of regulating and controlling development of plant stems and lateral branches and application of gene GhD14
  • Gene GhD14 capable of regulating and controlling development of plant stems and lateral branches and application of gene GhD14
  • Gene GhD14 capable of regulating and controlling development of plant stems and lateral branches and application of gene GhD14

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Expression patterns of GhD14 gene at different stages of cotton fiber development

[0035]1. Extract the RNA of 0DPA, 3DPA, 5DPA, 10DPA, 15DPA, 20DPA and other tissues of Xuzhou Cotton 142 in different stages of root, stem, leaf and fiber development, reverse transcribe into the first strand cDNA, and design primers according to the dominant gene sequence , GhD14-QRT-F: CCTTGTGACGGTTCCTTGCCA, GhD14-QRT-R: GAAGCACCGGGATGACGATATC, Q-PCR amplification was performed.

[0036] 2. The procedure used to complete the above experiment was pre-denaturation at 95°C for 15s; denaturation at 95°C for 5s, refolding at 60°C for 34s, extension at 72°C for 40s (data receiving); a total of 40 cycles.

[0037] 3. The internal reference gene used to complete the above test is GhUBQ7, and the primer sequence is GhUBQ7-F: GGCATTCACCTGACCAACAA, GhUBQ7-R: CCGCATTAGGGCACTCTTTTC

[0038] 4. For each of the above reactions, 3 biological repeats and 3 technical repeats were set up, and...

Embodiment 2

[0041] Example 2: Obtaining and Phenotypic Analysis of GhD14 Transgenic Arabidopsis Plants

[0042] 1. Construction of recombinant plasmid pCAMBIA2300-GhD14pro-GUS vector and acquisition of plants

[0043] 1. Use primers to amplify to obtain a sequence of about 1893 bp as shown in SEQ ID No.2. The primer sequences are listed in the table below. Primers were designed using the cotton genome (https: / / cottonfgd.org / ) sequence as a reference, and the full-length GhD14 gene was obtained by PCR amplification. The DNA of cotton seedling tissue was used as a template to amplify the full length of the GhD14 gene promoter with carrier adapter primers, and the underlined primers in the following table are the sequences of the target genes.

[0044]

[0045] 2. The promoter was linked to the upstream of the GUS coding sequence by homologous recombination to obtain the recombinant plasmid pCAMBIA2300-GhD14pro-GUS.

[0046] 3. The above-mentioned recombinant plasmid was introduced int...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and discloses a related gene GhD14 capable of regulating and controlling plant stem elongation and lateral branch development and application of the gene GhD14. A nucleotide sequence of the gene is as shown in SEQ ID No.1. By introducing the gene GhD14 into a plant, especially cotton, overexpression is performed to obtain a transgenic plant with the increased plant height and the reduced stem branch number. The gene provides a new thought for development mechanisms of plants, and has important significance in the growth and development research of the plants.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com