Unlock instant, AI-driven research and patent intelligence for your innovation.
A method of using ramie bnxth2 gene to improve pepper cold resistance
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A pepper and genetic technology, applied in genetic engineering, plant genetic improvement, botany equipment and methods, etc., can solve problems such as weak light and affecting pepper production, and achieve the effect of improving cold resistance
Active Publication Date: 2021-12-21
HUNAN AGRICULTURAL UNIV
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0002] Pepper (Capsicum anmuum L.) is an important temperature-loving vegetable. It has a large planting area in northern protected areas. However, due to the low temperature and weak light in winter, the production of pepper in the northern region is affected.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0035] 1. Extraction of total RNA and synthesis of first-strand cDNA
[0036] Use RNA extraction kit to extract pepper total RNA; then take 5 μL total RNA,
[0037] The complete ORF of BnXTH2 (sequence is SEQ ID NO: 1) was cloned according to transcriptome sequencing of the BnXTH2 gene fragment, and the coding amino acid sequence (sequence is SEQ ID NO: 2) was deduced.
[0038] 2. Sequence analysis
[0039] After analysis, it was found that the long open reading frame of BnXTH2 cDNA was 870bp, and predicted to encode 289 amino acids. It was found that BnXTH2 protein had typical GH16_XET and Glyco_hydro_16 domains, and belonged to XET_C superfamily, LamG superfamily and SKN1 superfamily.
Embodiment 2
[0041] This example provides a BnXTH2 transgenic test method, specifically transducing the BnXTH2 gene into peppers, and observing the phenotypic changes of the transgenic peppers at low temperature.
[0042] 1. Construction of BnXTH2 gene overexpression vector
[0043] Construction of S1, BnXTH2 gene overexpression vector;
[0044] 1.1) Extract the total RNA of the whole plant and reverse transcribe it into cDNA;
[0045] 1.2) Using the cDNA obtained in step 1.1) as a template, PCR amplification was performed using primers BnXTH2-F and BnXTH2-R to obtain the open reading frame of BnXTH2 with restriction sites;
[0046] BnXTH2-F:CGGGATCCATGAGATCATCATCAAGTAGT;
[0047] BnXTH2-R:CGAGCTCCTAGTAGCCAGCGAGGCACT;
[0048] 1.3) Digest the expression vector pBI 121 and BnXTH2 fragments, the restriction system is as follows:
[0049]
[0050] React overnight at 37°C, and recover the target PCR fragment by gel electrophoresis;
[0051] 1.4) Using T4 ligase to connect the PCR fragm...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a method for improving plant cold resistance by utilizing BnXTH2 gene. The method specifically comprises heterologous expression of BnXTH2 gene in pepper. Experiments have proved that the cold resistance ability of pepper can be significantly improved by heterologous expression of BnXTH2 gene in pepper.
Description
technical field [0001] The invention relates to the field of biotechnology, in particular to a method for improving cold resistance of peppers by using ramie BnXTH2 gene. Background technique [0002] Pepper (Capsicum anmuum L.) is an important temperature-loving vegetable, which is planted in a large area in northern protected areas. However, due to low winter temperature and weak light, the production of pepper in northern areas is affected. Overwintering at the seedling stage is vulnerable to sudden cold snap and low temperature (below 0°C) frost or early spring rainy low temperature (above 0°C), which seriously affects the growth, early yield and commerciality of pepper. There is an urgent need for a technology to enhance the cold resistance of peppers. [0003] Recent studies have found that XTH5 / 7 overexpression (oxXTH5, oxXTH7) transgenic plants under low temperature treatment plant survival experiments found that overexpression of XTH gene can promote the accumulati...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More