Unlock instant, AI-driven research and patent intelligence for your innovation.

A primer set for the detection of small non-coding RNAs by multiplex fluorescent quantitative PCR based on the stem-loop method

A fluorescent quantitative, non-coding technology, applied in the field of fluorescent quantitative PCR, can solve the problems of complex components and cumbersome steps, and achieve the effects of preventing product contamination, easy operation, and increasing accuracy

Active Publication Date: 2022-01-18
广州血康陆道培生物技术有限公司
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Based on this, patent CN201510639411 discloses a method for developing miRNA multiplex detection based on stem-loop RT-PCR, which includes reverse transcription, single-strand complementary extension, S1 nuclease digestion, solid-phase adsorption extraction and fluorescence quantitative detection steps, but its The steps are cumbersome and the components are more complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer set for the detection of small non-coding RNAs by multiplex fluorescent quantitative PCR based on the stem-loop method
  • A primer set for the detection of small non-coding RNAs by multiplex fluorescent quantitative PCR based on the stem-loop method
  • A primer set for the detection of small non-coding RNAs by multiplex fluorescent quantitative PCR based on the stem-loop method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1 Primer and probe design

[0059] The design is mainly divided into 3 steps:

[0060] ① Design reverse transcription extension primers for the non-coding small RNA sequence to be tested.

[0061] ②Using the small RNA stem-loop reverse transcription method to design reverse transcription primers;

[0062] ③Design general upstream and downstream primers and specific probes corresponding to the corresponding sequences, and then detect non-coding small RNAs. The specific design ideas are as follows: figure 1 .

[0063] The specific design is as follows:

[0064] 1. Reverse transcription extension primer: the reverse transcription extension primer is sequenced from the 5' end to the 3' end: the upstream general primer sequence and the specific binding sequence 1; the specific binding sequence 1 is the same as the non-coding small The 6-15 bases of the 5' end of the RNA are the same; the sequence of the upstream universal primer is 16-25 bases; the 3' end of t...

Embodiment 2

[0069] Example 2 Primer Set Design Example

[0070] Corresponding primers and probes were designed for miR-21-5p (nucleotide sequence shown in SEQ ID NO.1: UAGCUUAUCAGACUGAUGUUGA) by the method of Example 1.

[0071] As shown in Table 1, the 3' end of the designed reverse transcription extension primer has a length of 15 bases, and the underlined sequence is consistent with the 5' end sequence of the Has-miR-21-5p sequence (that is, specific binding or complementary sequence), the nucleotide sequence is shown in SEQ ID NO.2. At the same time, upstream universal primers, downstream universal primers, and specific probes are designed for the amplified fragments, and their nucleotide sequences are respectively shown in SEQ ID NO.3-6. The underlined sequence of the reverse transcription primer (i.e. RT primer) is the region complementary to the 3' end of the target sequence.

[0072] Table 1 Primer and probe sequence list

[0073]

Embodiment 3

[0074] Example 3 A detection method for detecting non-coding small RNAs by multiplex fluorescent quantitative PCR

[0075] 1. Extract sample non-coding small RNA

[0076] The miRcute kit kit was used to extract small non-coding RNA from samples, and the concentration and purity of RNA (OD260 / OD280) were determined by UV spectrophotometry.

[0077] 2. Reverse transcription

[0078] Use the reverse transcription extension primer and the stem-loop reverse transcription primer to perform reverse transcription, prepare the reverse transcription system in the PCR tube, then place the PCR tube in the ABI2720 PCR instrument, incubate at 25°C for 5min, at 50°C for 15min, and at 85°C for 5min, 4°C hold. The reversed product was immediately subjected to qPCR reaction or stored at -20°C.

[0079] Reverse transcription system: 5×RT buffer 4 μL; dNTPs (10 mM each) 1 μL; each RT extension primer (2 μM) of each non-coding small RNA to be tested 1 μL; each stem-loop reverse transcription pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer set for detecting non-coding small RNAs by multiplex fluorescent quantitative PCR based on the stem-loop method. The present invention establishes a method for detecting non-coding small RNAs by multiple fluorescent quantitative PCR based on the stem-loop method, and realizes simultaneous PCR amplification of reverse transcription products of multiple targets by a pair of upstream and downstream universal primers. The reverse transcription extension primer is added during the reverse transcription process, which can extend the reverse transcription product. Because the length of the amplification product is increased, the design of upstream primers and probes can be greatly facilitated; multiple target miRNAs can be processed in a single tube reaction Reverse transcription, and then perform multiple fluorescent quantitative PCR detection to realize multiple detection of miRNA based on stem-loop reverse transcription primers, which is easier to operate and more in line with the clinical diagnostic application requirements of joint expression analysis of multiple target miRNAs.

Description

technical field [0001] The present invention relates to the technical field of fluorescent quantitative PCR, and more specifically relates to a primer set for detecting non-coding small RNAs by multiple fluorescent quantitative PCR based on stem-loop method. Background technique [0002] MicroRNA, or miRNA, is a class of non-coding single-stranded RNA molecules encoded by endogenous genes with a length of about 22 nucleotides. Studies have shown that miRNA is involved in the occurrence and development of diseases. Therefore, the detection of miRNA expression differences can provide ideas for disease screening and diagnosis, thereby realizing the application of miRNA in clinical diagnosis. It is generally believed that it is difficult to achieve effective diagnosis of diseases using the expression changes of a single miRNA target. The application of miRNA in clinical diagnosis can be effectively realized only by combining multiple miRNA targets with reference to internal re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6851C12Q1/6883C12N15/11
CPCC12Q1/6851C12Q1/6883C12Q2600/16C12Q2600/178C12Q2525/301C12Q2531/113C12Q2533/101C12Q2537/143C12Q2561/101C12Q2563/107C12Q2521/531
Inventor 周其伟王军刘刚
Owner 广州血康陆道培生物技术有限公司